Ein oder zwei Felder im kreationistischen Bullshit-Bingo dürfte der republikanische Präsidentschaftskandidaten-Kandidat Rick Santorum in der einen Minute schon vollgekriegt haben, die er hier über seine Forderung, auch Kreationismus an öffentlichen Schulen der USA (ja, Santorum ist ein ehemaliger Senator aus Pennsylvania, falls sich jemand gefragt hat) schwadronieren darf. Ich bin mir sicher, dass er im (hier wiedergegebenen) Rest dieser Ausführungen noch ein paar Felder mehr abhakt:

flattr this!

Kommentare (65)

  1. #1 Dr. Webbaer
    30. November 2011

    Es gibt leider linke wie rechte, also politische Wissenschaft.

    Wobei man die beiden Richtungsangaben längere Zeit debattieren könnte, ‘Rechts’ heißt in etwas: antilinks, also dem Umverteilungsgedanken abhold und ein retardierend.

    In D findet ja lustigerweise ein staatlich gesponserter Kampf gegen “Rechts” statt, hier muss Doitschland ein wenig aufpassen, denn “Rechts” ist eine natürliche politische Richtung.

  2. #2 ZielWasserVermeider
    30. November 2011

    @Dr. Webbaer – Thema verfehlt, 6, setzen!

    Zum Thema

    Lying for Jesus:

    Da die Creotards nichts in der Hand haben, daß in irgendeiner Weise an der Theorie der Evolution oder dem Fakt der Evolution kratzen kann, versuchen sie es mit Lügen und Unterstellungen. Ein Paradebeispiel dafür ist der Kitzmiller./.Dover -Prozess:

    http://en.wikipedia.org/wiki/Kitzmiller_v._Dover_Area_School_District

    Die politische Clientel und die Politiker, die sie bedienen kommen zum Großteil aus dem Block den man in den USA rechts bzw. konservativ nennt. Dieser Block fördert die Wissenschaftsfeindlichkeit, die vielen Wissenschaftlern in den USA Sorgen bereitet.

    “Teach the Contoversity”

    ist der Slogan dieser Leute. Und nicht nur im Feld der Biologie sind die tätig sondern auch bei den Klimawissenschaften. Auch dort können die “Skeptiker” Leute aus dem religioten Umfeld gewinnen wenn sie von den “bösen linken liberalen Wissenschaftlern” und ihrer Agenda, den Leuten Geld abzuknüpfen, reden.

    Gruß
    Oli

  3. #3 Jonas
    30. November 2011

    Ich hätte da mal eine Frage:
    Was sollte die Schule im Fach Biologie lehren? Evolution nach Darwin/Wallace…ist klar. Was ist mit der “Schöpfungslehre” (keine Ahnung ob das der Fachbegriff ist)? Gar nicht ansprechen? Was ist mit Lamarck? Als überholt ansprechen oder auch ausklammern?

    Oder ganz allgemein: Sollte auch schon in der Schule als fehlerhaft erkannte naturwissenschaftliche (bitte im weitesten Sinne verstehen, damit die Schöpfunglehre mit geht) Theorien bearbeitet werden oder sollte nur der aktuelle Stand der Dinge Stoff sein?

    Falls dies zu sehr OT sein sollte, bitte ich um Verzeihung.

  4. #4 ZielWasserVermeider
    30. November 2011

    @Jonas

    Schöpfungsmythen haben meiner Meinung nach nichts im Biologieunterricht zu suchen(ausser vielleicht als Fußnote).
    Widerlegte und/oder auch überholte Theorien sollten aber zumindest aufgezeigt werden um zu zeigen warum sich letztendlich die Evolutionstheorie(n) in der Biologie durchgesetzt hat/haben. Also die Entwicklung die zu unserem heutigen Stand der Wissenschaft geführt hat.

    Gruß
    Oli

  5. #5 Para
    30. November 2011

    @Jonas

    Sollte auch schon in der Schule als fehlerhaft erkannte naturwissenschaftliche (bitte im weitesten Sinne verstehen, damit die Schöpfunglehre mit geht) Theorien bearbeitet werden oder sollte nur der aktuelle Stand der Dinge Stoff sein?

    Der Witz ist, die Schöpfung ist keine Theorie. Eine Theorie setzt vorraus das eine Hypothese gegen die Nullhypothese getestet wurde. D.h. wenn Modell “Evo” richtig ist, verhällt sich im Experiment A Organismus B wie “x”.
    Beim Mythos ist sowas nicht möglich, daher ist er nicht naturwissenschaftlich und in dem Sinne auch keine Theorie.
    Was hat sowas dann noch in einem naturwissenschaftlichen Unterrichtsfach zu tun (außer als Beispiel wie Wissenschaften eben NICHT arbeiten) ?

    Lehren kann man in Bio noch genug, Grundzüge der Ökologie, Evolution, Physiologie, Genetik, Taxonomie… an Stoff mangelt es ganz sicher nicht. Veraltete Theorien zu lehren hat Sinn da es schön zeigt wie Wissenschaften arbeiten, warum sich bestimmte Modelle eben durchsetzten und andere halt nicht.

  6. #6 BreitSide
    1. Dezember 2011

    xxx

  7. #7 Ronny
    1. Dezember 2011

    Neulich hörte ich mal eine sehr interessante Aussage von einem gebildeten Menschen
    ‘Was soll ich tun, ich muss ja Kreationist sein wenn ich Christ sein will’

    Das hat mich schon etwas schockiert. Frei nach dem Motto: Wenn ich da mitmachen will, dann muss ich etwas verteidigen was mir selbst seltsam vorkommt. Just au.

    Zum Thema links/rechts. Extremismus ist immer schlecht und wenn man links weit genug rausgeht kommt man rechts wieder rein.

    Außerdem, Rechte greifen Menschen an die anders aussehen und Linke greifen Menschen an die anders denken. Ist nur eine andere Ebene.

  8. #8 maxfoxim
    1. Dezember 2011

    @ ronny: “Zum Thema links/rechts. Extremismus ist immer schlecht und wenn man links weit genug rausgeht kommt man rechts wieder rein.

    Außerdem, Rechte greifen Menschen an die anders aussehen und Linke greifen Menschen an die anders denken. Ist nur eine andere Ebene.”

    Vollkommen richtig. Besonders wenn man das ganze mal aus Opfersicht betrachtet. Letztendlich ist egal ob man von linken ermordert wird, weil man Arbeitgeberpräsident ist, oder von rechten weil man die falsche Hautfarbe hat.

    Es würde die Angehörigen auch nicht trösten, wenn es ein “unpolitischer” Mord gewesen wäre.

  9. #9 cydonia
    1. Dezember 2011

    @Ronny
    Die Aussage des Christen ist konsequent und nachvollziehbar. Ich kann für meinen Teil absolut nicht nachvollziehen, wie man an einem Glauben festhalten kann, wenn man alle naselang etwas bis zu einem bestimmten Zeitpunkt sicher Geglaubtes mal eben in die Tonne tritt, weil man sich der Erkenntnis nicht mehr verschließen kann , dass es nicht zur Realität passt. Entweder man trennt sich vom Glauben, oder man hält konsequent an allen Blödsinnigkeiten fest. Alles andere ist Selbstbetrug.
    Und “Links” und “Rechts” sind meistens Stempel ohne Wert, die von Menschen benutzt werden, um andere, je nach eigener Position, zu diskreditieren. Definiert ist das Ganze nicht im Geringsten.

  10. #10 Anne
    1. Dezember 2011

    Ich bin eindeutig dafür das im Biologieunterricht zukünftig auch ausführlich über Leben, Fortpflanzung und Soziologie von Drachen, Feen und Erdtrollen gesprochen wird. 😉

  11. #11 Enkrod
    1. Dezember 2011

    @cydonia:
    Richtig! Glaube und Wissenschaft verhalten sich wie Materie und Antimaterie, wo das Eine ist, kann das Andere nicht sein. Denn das Eine verurteilt den blinden Glauben und fordert Beweise, während das Andere lehrt keine Beweise zu verlangen sondern blind zu glauben.

    Ich möchte an dieser Stelle wieder mal Richard Dawkins verlinken, einfach weil ich glaube dass man diesen Link gar nicht oft genug in solchen Diskussionen posten kann.
    http://www.ted.com/talks/lang/en/richard_dawkins_on_militant_atheism.html

  12. #12 Donnamara
    1. Dezember 2011

    @ ZielWasserVermeider

    “Schöpfungsmythen haben meiner Meinung nach nichts im Biologieunterricht zu suchen(ausser vielleicht als Fußnote).
    Widerlegte und/oder auch überholte Theorien sollten aber zumindest aufgezeigt werden um zu zeigen warum sich letztendlich die Evolutionstheorie(n) in der Biologie durchgesetzt hat/haben. Also die Entwicklung die zu unserem heutigen Stand der Wissenschaft geführt hat.”

    Genau derselben Meinung bin ich auch. Der Mythos der Schöpfung durch Evolution, welche durch Zufall zustandegekommen sein soll, ist noch niemals bewiesen worden. Daß durch intelligente Schöpfung etwas Vernünftiges zustandekommen kann, sehe ich z.B. an meinem Schornstein oder der Energiesparlampe. Daran kann ich sogar erkennen, daß eine Evolution offensichtlich nicht stattgefunden hat. Es gibt nämlich 5, 7 ,9, 13 und 23 W Lampen und diese lassen sich nicht ineinander umwandeln. Selbst Modelle derselben Leistung sehen oft völlig anders aus und können sich nicht aus den anderen Modellen entwickelt haben. Sie wurden offensichtlich entwickelt. Ich glaube sogar, nicht einmal die Verpackung der Lampen hätte der Zufall zumachen können.

    Als Fußnote könnte man daher durchaus zulassen, das es früher eine andere Schöpfungshypothese gegeben hat. So etwa die Evolutionsthese, welche aber keinerlei Beweise für die behaupteten Zufallskräfte vorzeigen konnte. Die Kinder wollen schließlich etwas zum Lachen haben.

  13. #13 cydonia
    1. Dezember 2011

    Donnamara, wenn man nicht einmal ansatzweise eine Ahnung hat, worum es sich bei der Evolutionstheorie handelt, darf man auch schweigen, bevor man sich unsterblich blamiert.
    Demonstrationen, dass gläubige Menschen sich nicht für die Realität interessieren und agressiv gegen denkende Menschen stänkernm gibts genug. Da musst du mit deiner extrem primitiven Sicht der Dinge nicht auch noch kommen.

  14. #14 georg
    2. Dezember 2011

    @cydonia
    Ich meine, mich erinnern zu können, dass du dich schon mal darüber beklagt hast, dass es unter den Leuten, die sich selbst als Christen bezeichnen, kaum noch welche gibt, die die Geschichten in der Bibel noch wirklich ernst nehmen.

    In dem Fall solltest du dich doch eher freuen, wenn mal so ein unterbelichtetes Exemplar tasächlich auftaucht und dann nicht gleich so schroff rangehen 😉

    mfg georg

  15. #15 Para
    2. Dezember 2011

    @Donnamara

    Es ist der klassische Denkfehler die Evo auf Zufall zu reduzieren, denn Selektion ist das Gegenteil davon. Lässt du “Selektion aus”, redest du auch nicht mehr von Evo-Theorie und deine “Kritik” ist damit nichts sagend.

  16. #16 ZielWasserVermeider
    2. Dezember 2011

    Ach Donnamara, ich denke ich bin der falsche Ansprechpartner wenn es um den “Golden Crocoduck Award” geht. Dazu musst du eine Video zu dem Thema machen und es auf Youtube hoch laden.

    Am besten nach Neujahr, damit du für 2012 nominiert werden kannst.
    Ich geb dir bestimmt meine Stimme!
    So als Motivation.

    GRuß
    Oli

  17. #17 Donnamara
    2. Dezember 2011

    @Para

    “Es ist der klassische Denkfehler die Evo auf Zufall zu reduzieren, denn Selektion ist das Gegenteil davon. Lässt du “Selektion aus”,”

    Bevor es etwas zum Selektieren geben kann, muß der Schrott sich erst einmal entwickelt haben. Ausselektiert wird nämlich nur der Schrott.

    Wie also soll die notwendige Entwicklung von z.B. einem kleinen Schritt von 10000 richtigen Basenpaaren entsprechend 20000 bit mit Zufall funktioniert haben, Träumer?

    Wenn das so funktionieren könnte, hätte wohl jeder der Anwesenden schon einmal 30 Sechser im Lotto gehabt und müßte sich nicht mit 500 € alimentieren lassen.

  18. #18 Donnamara
    2. Dezember 2011

    @ZielWasserVermeider

    “Dazu musst du eine Video zu dem Thema machen und es auf Youtube hoch laden.”

    So ein Video gibt es bereits. Auch wenn es etwas christlich angehaucht ist, erscheint die Problematik gut dargestellt.

    Die Eingangsprämisse ist zwar nicht ganz exakt richtig, da die Evolution das Problem gar nicht angeht, wie aus toter Materie Leben entstehen kann, aber auch der Weg von einer Urzelle zu höherem Leben ist genauso schwierig.

    Unabhängig davon kommt die Evolution nicht darum herum zu erklären, wie das erste Leben überhaupt entstanden sein kann.


    http://www.youtube.com/watch?v=yIxl3hu1eVc&feature=related

  19. #19 Roland
    2. Dezember 2011

    @donnamara:

    sehe ich z.B. an meinem Schornstein oder der Energiesparlampe. Daran kann ich sogar erkennen, daß eine Evolution offensichtlich nicht stattgefunden hat. Es gibt nämlich 5, 7 ,9, 13 und 23 W Lampen und diese lassen sich nicht ineinander umwandeln.

    Wow, du hast lebende Schornsteine und Lampen? Vermehren die sich auch bei dir?

  20. #20 ZetaOri
    2. Dezember 2011

    @Roland· 02.12.11 · 22:28 Uhr

    Wow, du hast lebende Schornsteine und Lampen? Vermehren die sich auch bei dir?

    Na klar, siehst Du doch an der Größe der Lampen: Papa, Mama und drei Kinderlein, wie die Orgelpfeifen, natürlich alle ehelich gezeugt!!1elf!

  21. #21 BreitSide
    3. Dezember 2011

    Schon wieder ein nicht funzender Benachrichtiger. Neuer Versuch. Und ab in die Lesezeichen.

  22. #22 Donnamara
    4. Dezember 2011

    @Roland
    “Wow, du hast lebende Schornsteine und Lampen? Vermehren die sich auch bei dir?”

    Leider eben nicht. Beim Leben ist auch das Problem der Selbstvermehrung gelöst, was bei unseren Konstruktionen noch in weitester Ferne liegt. Übliche Affenlogik besagt zwar, je komplexer ein System ist, desto einfacher muß dessen Entwicklung gewesen sein. Aber persönlich kann ich diese Logik einfach nicht akzeptieren, weil sie mit normalem Verstand gemessen mehr als absurd erscheint. Es handelt sich daher zweifelsfrei um degenerierte Affenlogik.

  23. #23 Wb
    4. Dezember 2011

    Neulich hörte ich mal eine sehr interessante Aussage von einem gebildeten Menschen
    ‘Was soll ich tun, ich muss ja Kreationist sein wenn ich Christ sein will’

    Hüstel, besonders gebildet kann der Kollege nicht gewesen sein. – Hat sich vielleicht auf einige christliche amerikanische Gruppen bezogen…

    BTW, die Wissenschaften und die Wissenschaftler gelten in den Staaten oft als “Links”, weil das dortig tätige Humanpersonal verblüffend oft “links” ist und die Kollegen oft außerhalb der Wirtschaft arbeiten, immer schön subventioniert vom Staat. – “Je mehr Staat, desto besser für uns.” scheint aus dem einen oder anderen dort direkt herauszusprechen, und Staatsbegeisterte sind idR nicht liberal [1].

    MFG
    Wb

    [1] wobei der Begriff der Liberalität amüsanterweise in den Staaten auch in linke Hände geraten ist, aber das ist ein Thema für sich

  24. #24 Wb
    4. Dezember 2011

    Der Witz ist, die Schöpfung ist keine Theorie. Eine Theorie setzt vor[r]aus [, ] das[s] eine Hypothese gegen die Nullhypothese getestet wurde.

    Eine Theorie ist eine Sicht auf eine Datenlage. Natürlich ist die biblische Schöpfung eine Theorie.

    BTW, manche unterscheiden noch zwischen Hypothesen (Unterstellungen) und Theorien, manche meinen, dass Hypothesen eine gewisse Konsistenz haben müssen, um dann sozusagen zum Theorie-Sein qualifiziert zu sein, was aber eher etwas für linguistische Feinschmecker ist.

  25. #25 Para
    4. Dezember 2011

    @Donnamara

    Wie also soll die notwendige Entwicklung von z.B. einem kleinen Schritt von 10000 richtigen Basenpaaren entsprechend 20000 bit mit Zufall funktioniert haben, Träumer?

    1.) codierende Sequenzen sind in Relation zum Genom, sehr kurze Abschnitte
    2.) können in Sequenzen an zwei von drei Stellen neutrale Mutationen mitgeschleppt werden
    3.) setzt sich ja nicht “mal eben” ein komplettes Gen(om) spontan zusammen, sondern sukzessiv. Dies auch nicht nur durch Mutationen sonder auch durch den Einbau von Genabschnitten z.B. durch Transposons.
    Letztlich können bereits kleinste Änderungen in der Basenfolge große Wirkung haben -Schulbuchbeispiel-> Sichelzellenanämie.

    Von neuen Merkmalen durch Rekombination mal ganz zu schweigen.

    @WB

    Eine Theorie ist eine Sicht auf eine Datenlage. Natürlich ist die biblische Schöpfung eine Theorie.

    Umgangssprachlich mag das so sein, nicht jedoch in den Wissenschaften. Hier wäre die Schöpfung bestenfalls eine Hypothese.

  26. #26 Wb
    4. Dezember 2011

    Eine Theorie ist eine Sicht auf eine Datenlage. Natürlich ist die biblische Schöpfung eine Theorie. (Dr. Webbaer)

    Umgangssprachlich mag das so sein, nicht jedoch in den Wissenschaften. Hier wäre die Schöpfung bestenfalls eine Hypothese.

    Nicht im Rahmen der Geisteswissenschaften. Dass bei den N-Wissenschaften der eine oder andere bei komplexen Konzepten wie bspw. beim Pantheismus nur müde gähnt und geistig zu Hause bleibt, ist nicht überraschend.

    Was man wissen muss ist, dass die Wissenschaften über die Philosophie nach und nach entstanden sind, die Schöpfungslehre der Bibel ist hier durchaus als philosophisch-wissenschaftlich einordbar.

    Und natürlich: Man muss heutzutage aufpassen anderen nicht die Theorien wegnehmen zu wollen und bspw. szientistisch zu werden, was dumm wäre.

    MFG
    Dr. Webbaer

  27. #27 Para
    4. Dezember 2011

    @WB

    Die Entwicklung der Lebewesen ist eine naturwissenschaftliche Fragestellung. Demnach muss die Schöpfung wenns sie als “Alternative” herhalten will, naturwissenschaftlich betrachtet werden. Da ist der Mythos noch keine Theorie.

  28. #28 Wb
    4. Dezember 2011

    @Para
    Es gehört sich nicht den Theorien anderer, beispielhaft hier die Schöpfungslehre, den Status als Theorie abzuerkennen. Die Schöpfungslehre wird auch heute noch von verschiedenen christlichen Gruppen in unterschiedlicher metaphorischer Höhe gepflegt; wenn sich der Schreiber dieser Zeilen richtig erinnert hat Papst Pius hier einige wichtige Anpassungen vorgenommen…

  29. #29 Jürgen Schönstein
    4. Dezember 2011

    @WB
    Schlagen Sie doch erst mal den Unterschied zwischen Theorie und Dogma (i.e. Schöpfung) nach.

  30. #30 Wb
    4. Dezember 2011

    Dogmen sind von außen betrachtet immer Theorienmengen…

  31. #31 perk
    4. Dezember 2011

    Es gehört sich nicht den Theorien anderer, beispielhaft hier die Schöpfungslehre, den Status als Theorie abzuerkennen.

    sie sind der letzte der noch irgend ein recht hätte hier den moralapostel zu spielen und vorzuschreiben was “sich gehört”…

    Dass bei den N-Wissenschaften der eine oder andere bei komplexen Konzepten wie bspw. beim Pantheismus nur müde gähnt und geistig zu Hause bleibt, ist nicht überraschend.

    wenn doch nur alle so kluk (K. L. U. K.) wären wie der webbär.. und so belesen.. und intellektuell aufrichtig, und so bemüht um wissen und erkenntnis.. und hach die welt wäre ein traum..
    (zwar ein garstiger alptraum, aber immerhin wären alle die klügsten menschen der welt und hätten egos, die es ihnen aufgrund ihrer größe unmöglich machten sich jemals schlecht zu fühlen oder gar einen einzugestehen falsch liegen zu können)

    aber was solls, sie werden weiter hier auftauchen, leuten auf den teppich kacken (wie zum beispiel drüben bei martin, den sie immer wieder als ungebildeten deppen(dem webkompetente ursus auch als “und langanhaltendes Interesse zurückzuführen, sein beschränkter Realismus ist vermutlich branchenbedingt und seine Unfreundlichkeit darauf zurückzuführen, dass er nicht gerade der philosophische Turbolader ist und einiges nicht versteht, korrekt!” bekannt) bezeichnen ohne auch nur den hauch einer ahnung zu haben) und dann so tun als wäre ihre scheiße gold wert

    also: gehört sich ihr verhalten?

  32. #32 Donnamara
    4. Dezember 2011

    @Para
    “Letztlich können bereits kleinste Änderungen in der Basenfolge große Wirkung haben -Schulbuchbeispiel-> Sichelzellenanämie. ”

    Sicher. Es reicht bereits ein winziger Fehler aus, um Lebensunfähigkeit zu erzeugen. Genau dies widerlegt deine Affentheorie. Und wieviele Fehler geschehen dann während der Erdichtung eines neuen 20000 bit Codes, wenn es z.B. 10^10 richtige Möglichkeiten in dieser Zahlenmenge gibt? Und wie lange dauert es dann, um diesen Code “langsam” aufzubauen? Wie lange soll die Erde schon bestehen?

    Ich schätze, selbst billionen Erdalter reichen nicht aus.

  33. #33 Wb
    4. Dezember 2011

    @Albtraum-Falschschreiber
    Es ist ein Unterschied, ob man “in den Mann geht”, wenn dieser vorher selbst maulig aufgetreten ist, oder ob man einer ganzen Gruppe von Leuten die Theorien klaut und diese stattdessen als Mythen qualifiziert. Die Schöpfungslehre ist unzweifelhaft theoretisch, sie ist eine Sicht auf den Schöpfungsvorgang, da sind welche, die sehen das so. – Dass man als moderner Bär (oder Mensch) heutzutage eher andere Sichten pflegt, ist klar; dennoch: auch Einstein und Spinoza haben bestimmte in diese Richtung gehende Fragen gestellt und die SciFi-Literatur lebt von solchen Fragestellungen, die dann immer auch Sichten transportieren.

  34. #34 perk
    4. Dezember 2011

    Es ist ein Unterschied, ob man “in den Mann geht”, wenn dieser vorher selbst maulig aufgetreten ist, oder ob man einer ganzen Gruppe von Leuten die Theorien klaut und diese stattdessen als Mythen qualifiziert.

    ah.. ok.. sich wie ein depp aufführen und beleidigen: hui, definitionen korrekt anwenden und sachlich ein thema diskutieren: pfui..

    man muss es einfach nur aus der webbärensicht sehen und die welt ist so klar wie durch die brille glenn becks..

  35. #35 Wb
    4. Dezember 2011

    @Albtraum-Falschschreiber
    Normalerweise geht die Diskussion ja so, dass welche meinen bestimmte Theorien [1], der Kreationismus ist hier ein Klassiker, seien gar keine Theorien, sondern nur Hypothesen, die mangels Qualität und Beleglage keinen Theoriestatus erhalten dürften. [2]

    Hier kam mal einer auf die Idee gleich den Mythos auszupacken, deshalb hat der Webbaer sich ein wenig für dieses Detail interessiert…

    MFG
    Dr. Webbaer

    [1] bestimmte Theorien anderer, das ist die Pointe, es sind immer Theorien anderer Personen, die keine Theorien sein sollen
    [2] wobei natürlich die meisten Wissenschaftler selbst (und oft richtigerweise) sagen: “Ich habe eine Theorie.” und nicht “Ich habe eine Hypothese.”

  36. #36 Jürgen Schönstein
    5. Dezember 2011

    @WB
    Die “Schöpfung” ist weder Theorie noch Hypothese, sondern Dogma. Schlagen Sie’s einfach mal nach. Hypothesen – im wissenschaftlichen Sinn, und nur der steht hier zur Debatte, weil ja die in “intelligentes Design” verpackte Schöpfungs”lehre” als wissenschaftliche Alternative zur Evolutionslehre akzeptiert werden will – müssen bestimmte formale Anforderungen erfüllen, darunter ganz essentiell die der “Falsifizierbarkeit”, die u.a. auch bedeutet, dass bereits in der Formulierung die Möglichkeit enthalten ist, dass sie widerlegt werden kann. Glaubens-Statements schließen kategorisch die Möglichkeit des Zweifels aus – als Hypothesen sind sie also bereits formal disqualifiziert.

    Und ganz nebenbei: Für jemanden, der sich gelegentlich über Entstellungen seines eigenen großspurigen Nicknamens beschwert, gehen Sie mit den Kommentaridentitäten anderer ein bisschen zu generös um …

  37. #37 michael
    5. Dezember 2011

    > Für jemanden, der sich gelegentlich über Entstellungen seines eigenen großspurigen Nicknamens beschwert, gehen Sie mit den Kommentaridentitäten anderer ein bisschen zu generös um ..

    So macht das halt der bedeutende Wirtschaftsführer, wenn er seinen Untergebenen zeigen will, dass er unzufrieden mit ihnen ist.

  38. #38 Stefan W.
    5. Dezember 2011

    Ich würde die Schöpfungsgeschichten nicht als Theorien bezeichnen, sondern als Legenden. Statt einer plausiblen Erklärung, die mit sonstigem Wissen in Einklang steht, erfindet man eine Erzählung, die tradiert wird.

    “Falsifizierbarkeit” halte ich für eine wünschenswerte, aber teils heikle Anforderung, weil sich die Falsifizierbarkeit aus der Verfügbarkeit einer Technik ergeben kann, die es noch nicht gibt.

    Aber vom Selbstverständnis muss eine Theorie offen sein gegenüber der Konkurrenz einer besseren Theorie.

    Wenn man sagt, Gott habe den Menschen aus Ton geformt, und dann seinen Atem eingehaucht – wenn man dann offen wäre für Kritik, dass man das ja noch nie gesehen hätte, wie jmd. eine Figur aus Ton formt, die dann lebendig wird. Aber die Legende ist eine abgeschlossene Erzählung, die auch nicht durch Einschränkungen oder Hilfskonstruktionen stabilisiert wird. Sie wird auch nicht korrigiert oder ersetzt.

    Der Versuch die Schöpfungsgeschichte in der Schule zu erzählen ist ja auch nicht ein Theorieansatz, der die Welt erklären soll, sondern der Versuch der Missionierung. Man will nicht wissen, wo der Mensch herkommt, sondern seinen Fetisch aufdrängen und Dominanz erreichen und ausdrücken.

  39. #39 Para
    6. Dezember 2011

    @ Donnamara

    Sicher. Es reicht bereits ein winziger Fehler aus, um Lebensunfähigkeit zu erzeugen. Genau dies widerlegt deine Affentheorie. Und wieviele Fehler geschehen dann während der Erdichtung eines neuen 20000 bit Codes, wenn es z.B. 10^10 richtige Möglichkeiten in dieser Zahlenmenge gibt? Und wie lange dauert es dann, um diesen Code “langsam” aufzubauen? Wie lange soll die Erde schon bestehen?

    Ich schätze, selbst billionen Erdalter reichen nicht aus.

    1. Nochmal, der wirklich “relevante” Teil des Genoms ist verschwindend gering.
    2. Wie schon geschrieben, sind in den Triplets 2 von 3 Stellen (1. und 3. Codon) recht variabel. Es ist daher unsinnig auf eine exakte Sequenz zu pochen.
    3. Gibt es zig Reperaturmechanismen
    4. Es ist ebenso unsinnig einen “Jetzt-Zustand” einer beliebigen Sequenz zu nehmen und deren “unmögliche Entstehung aus dem Nichts” und zu postulieren. Niemand behauptet das dies so der Fall war.

    @Wb
    Es gehört sich auch nicht einen Anspruch von “Wissenschaftlichkeit” zu stellen, wenn die entsprechenden Kriterien nicht erfüllt sind.

  40. #40 peter hofer
    7. Dezember 2011

    Zitat Stefan W.: “”Falsifizierbarkeit” halte ich für eine wünschenswerte, aber teils heikle Anforderung, weil sich die Falsifizierbarkeit aus der Verfügbarkeit einer Technik ergeben kann, die es noch nicht gibt. ”

    Hier wird Popper oft missverstanden. Das Kriterium der Falsifizierbarkeit bezieht sich nicht auf die technisch mögliche Falsifizierbarkeit von Sachverhalten, sondern audf die logische Falifizierbarkeit von Sätzen. Beispiel:

    Der Satz “Im Inneren des Mondes gibt es keinen grünen Käse” ist mit heutigen Methoden praktisch nicht falsifizierbar. Sehr wohl ist der Satz aber so formuliert, dass er logisch sehr wohl falsifizierbar ist.

  41. #41 Dr. Webbaer
    7. Dezember 2011

    @Schönstein

    Die “Schöpfung” ist weder Theorie noch Hypothese, sondern Dogma.

    Die Schöpfungslehre ist Dogma und für den Außenstehenden eine Sicht auf die Schöpfung, eine Theorie. – Wo liegt hier Ihr Problem genau?

    Hypothesen – im wissenschaftlichen Sinn, und nur der steht hier zur Debatte, weil ja die in “intelligentes Design” verpackte Schöpfungs”lehre” als wissenschaftliche Alternative zur Evolutionslehre akzeptiert werden will – müssen bestimmte formale Anforderungen erfüllen, darunter ganz essentiell die der “Falsifizierbarkeit” (…)

    Das sagen Sie!, lieber Herr Schönstein, es herrscht allerdings Theorienfreiheit. In den Geisteswissenschaften sowieso und zudem ist auch die Falsifizierbarkeit nicht zwingend gefordert und immer nützlich, bspw. bei Meta-Theorien gar nicht möglich (die Forderung an Theorien falsifizierbar zu sein beispielsweise, wäre als Meta-Forderung selbst nicht dementsprechend ansprechbar). Zuletzt: Auch die N-Wissenschaften theoretisieren frei, beachten Sie vielleicht auch wie locker man bei der Überschreitung der Lichtgeschwindigkeit bei der Signalübertragung mittlerweile bleibt. Sogar teilfalsifizierte Theorien behalten (in Teilen 🙂 ihren Wert.

    Nun soll hier nicht der Kreationismus verteidigt werden, aber man sollte nun wirklich die ihn vertretenen Kollegen bestmöglich ernstnehmen und ihnen nicht die grundsätzlichen wissenschaftlichen Mittel arroganterweise aberkennen wollen.

    @Para
    Jaja, Sie wissen, was (moderne?) Wissenschaftlichkeit ist, gell. S-Wort btw,, denn mit Wissen hat das nichts zu tun, im Englischen unterscheidet man denn auch sinnvollerweise zwischen Science und den Humanities…

    HTH
    Dr. Webbaer

  42. #42 Dr. Webbaer
    7. Dezember 2011

    Ergänzend vielleicht noch zum Theorienwesen:
    Theorien beschreiben (“Erde dreht sich um Sonne”), erklären (“Newton”) und erlauben die Prognose (“wird sich weiterdrehen bis auf Weiteres”), wobei diese drei Theorienteile optional sind, eines reicht.
    Weitergehende Forderungen sind Dr. W im Moment nicht bekannt. Aber fordern Sie ruhig. – Vielleicht in diesem Zusammenhang auch die seinerzeitigen Tiefpunkte zK nehmen, in dem sich zwei SB-Blogger darüber gestritten haben, ob Theorien erklären oder beschreiben, lol. Zumindest hat’s Dr. W so abgelegt, vielleicht ist ihm etwas entgangen bei Dr. B und JF seinerzeit…

  43. #43 perk
    7. Dezember 2011

    Die Schöpfungslehre ist Dogma und für den Außenstehenden eine Sicht auf die Schöpfung, eine Theorie. – Wo liegt hier Ihr Problem genau?

    my take on that:
    das problem besteht darin, dass sie nix beizutragen haben, als immer nur ihr eigenes pippi langstrumpf lied zu trällern..

    Sogar teilfalsifizierte Theorien behalten (in Teilen 🙂 ihren Wert.

    wie immer: belegen oder klappe halten

    oder anders: ihr in unverständnis gezeichnetes bild von naturwissenschaft ist nichts wonach man ihre leistungsfähigkeit beurteilen kann

    Nun soll hier nicht der Kreationismus verteidigt werden, aber man sollte nun wirklich die ihn vertretenen Kollegen bestmöglich ernstnehmen und ihnen nicht die grundsätzlichen wissenschaftlichen Mittel arroganterweise aberkennen wollen.

    wissenschaft untersucht den wahrheitsgehalt von vermutungen (“wenn ich A bei meiner nach reproduzierbaren methoden angestellten untersuchung überprüfe, erwarte ich bei gültigkeit der theorie B ergibnis C”)
    das ist bei kreationismus, schöpfungsdogma und der gleichen nie gegeben:
    dort wird nicht theoretisiert sondern axiomatisiert

    der schöpfer ist keine theorie, sondern ein axiom

  44. #44 Theres
    7. Dezember 2011

    Protest:
    Ein Axiom ist der Grundsatz einer Theorie, und noch einiges andere, inklusive ein französischer Rapper. Der ist kaum Gott, hm?

    Im Ernst, eine Lebensmaxime (ein mögliches Synonym für Axiom) ist einer der angeblich existierenden Götter für seine Anhänger durchaus.

  45. #45 Dr. Webbaer
    7. Dezember 2011

    @perk
    Bitten Sie einfach freundlich um Belege und Sie bekommen welche, und nein, (Natur-)Wissenschaft [1] untersucht keinen ‘Wahrheitsgehalt’, haben Sie denn epistemologisch wirklich derartigen Schulungsbedarf?

    [1] tautologische Systeme, die sozusagen eigene Welten schaffen, ausgenommen

    MFG
    Dr. Webbaer (der sich Ihre Einwürfe in dieser Form nicht mehr lange antun wird)

  46. #46 Donnamara
    7. Dezember 2011

    @Para

    Ich hatte dir eine sehr konkrete Aufgabe gestellt, welche deine Einwände bereits berücksichtigten.

    “1. Nochmal, der wirklich “relevante” Teil des Genoms ist verschwindend gering.”

    Wenn ein 20000 bit Code verlangt ist, betrifft das natürlich den “verschwindend geringen Teil”.

    “2. Wie schon geschrieben, sind in den Triplets 2 von 3 Stellen (1. und 3. Codon) recht variabel. Es ist daher unsinnig auf eine exakte Sequenz zu pochen.”

    Ich habe nicht auf eine exakte Sequenz gepocht sondern auf eine (1) von 10^10 möglichen!

    “3. Gibt es zig Reperaturmechanismen”

    Das betrifft aber nicht das Erfinden des unbekannten Codes!

    “4. Es ist ebenso unsinnig einen “Jetzt-Zustand” einer beliebigen Sequenz zu nehmen und deren “unmögliche Entstehung aus dem Nichts” und zu postulieren. Niemand behauptet das dies so der Fall war.”

    Ob dies jemand nicht behauptet oder nicht, spielt keine Rolle. Es mußte irgendwann bei 0 angefangen dann 20000 funktionierende lebensfähige Bits erfunden worden sein, bis das Ding von selbst “laufen” konnte!

    Gerade dein Beispiel mit der Sichelzellenanämie beweist eben, daß der geringste Fehler zur Lebensuntüchtigkeit führt. Auch vei Inzucht ist dies der Fall. Hier werden nämlich die zweiseitig vorhandenen Fehler 1. fixiert und 2. kommen noch neue hinzu. Das Ergebnis ist dann wie aus der Zeitung jüngst bekannt (Vater-Tochter) lebensunfähiger Schrott.

    Sie waren also nicht in der Lage, die gestellte Aufgabe zu lösen und sind deshalb ausgewichen.

    Man könnte die Aufgabe noch mehr der Wirklichkeit anpassen, indem man “übliche” Mutationsraten annimmt, wo dann das Produkt noch nicht fertig ist aber dennoch “unpassend” mutiert. Dann wird das vorher Erreichte wieder zerstört. Selbst für die Erfindung eines nur 20 kb großen “weiterführenden” Codes ist dann die Wahrscheinlichkeit praktisch 0. Also irgendwo bei 10^(-1000 * X…..).

    Die Evolutionsspekulation ist wissenschaftlich gesehen unhaltbarer Schrott!

  47. #47 Jürgen Schönstein
    8. Dezember 2011

    @Donnamara
    Ja, und der Apfel fällt immer nach oben. Sachunkenntnis ist in diesem Forum keine Tugend.

    Das gilt auch für den auf Hochtouren schwafelnden
    @WB (auch Netzbär, Netzpetz, Schwätzpetz, WebBarsch etc. genannt – verdienter Maßen, da er auch gerne die Nicknamen anderer Kommentatoren verhunzt)
    Ein Dogma ist keine Hypothese und damit auch keine (aus Hypothesen aufgebaute) Theorie. Ein Dogma ist eine Aussage, die nicht angezweifelt werden darf (erneut die Aufforderung, den Begriff mal nachzuschlagen – ist nicht schwer). Eine “Falsifikation” des Dogmas ist, rein von der Logik her, nicht möglich. Allein schon der Versuch, die Aussage des Dogmas auf ihre Gültigkeit zu testen, verletzt die Grundlagen der Religion. Und von wegen “Theoriefreiheit” – sagt Ihnen der Name Hans Küng etwas? Aber dies sind nur rhetorische Fragen – BITTE NICHT BEANTWORTEN! Nein, ich muss es anders formulieren: Bitte kein Geschwätz absondern, denn “antworten” im semantischen Sinn tun Sie ja sowieso nie.

  48. #48 Para
    8. Dezember 2011

    @Donnamara

    noch immer nicht verstanden, also gut…

    1. Woher diese völlig willkührliche Zahl 20.000 -was ist gemeint, ein Genom oder ein Gen ? So nebenbei, Gene bei Eukaryoten (vereinfacht- alles, was jetzt mal kein “Bakterium” ist) sind auch keine durchlaufenden Sequenzen.
    2. was soll

    Ich habe nicht auf eine exakte Sequenz gepocht sondern auf eine (1) von 10^10 möglichen!

    bedeuten ? (bitte bitte nicht diese dumme “Wahrscheinlichkeit das genau Seq. X wie aus dem nichts entstehen kann”. Das hat mit Evo soviel zu tun wie Fahräder mit Pramiden)
    3.

    Das betrifft aber nicht das Erfinden des unbekannten Codes!

    Der Satz macht keinen Sinn. “Erfinden” bedeutet etwas neues, “unbekannt” ist aber schon da, nur nicht beschrieben. Neue Merkmale(!) werden auch nicht “erfunden” (da erfinden ein gerichtetes Ziel/Absicht impliziert), sondern sie entstehen durch Mutation, Einabau von Fremdgenen und Rekombination bereits vorhandener Genabschnitten.
    4.

    Ob dies jemand nicht behauptet oder nicht, spielt keine Rolle. Es mußte irgendwann bei 0 angefangen dann 20000 funktionierende lebensfähige Bits erfunden worden sein, bis das Ding von selbst “laufen” konnte!

    Und ob es eine Rolle spielt ob Blödsinn behauptet wurde oder nicht. Ist ja deine Argumentation wenn du einen spezielle Seq. von 20.000 BP aus dem nichts willst. (was aber mit der Evo nichts zu tun hat und eher zeigt, dass du die Evo gar nicht verstanden hast).
    Gib bei Google Scholar doch einfach mal “Synthetic Self-Replicating Molecules” ein. (Wieso sollen die “Dinger” eigentlich erst bei 20.000 “von selbst laufen” ?)

    Gerade dein Beispiel mit der Sichelzellenanämie beweist eben, daß der geringste Fehler zur Lebensuntüchtigkeit führt.

    Blödsinn, dass Beispiel zeigt einzig das eine kleine Änderung eine große Wirkung haben kann. Hinzu kommt, dass der Fall sogar eine Ausnahme ist, da die meisten Merkmale über viele Gene gesteuert werden. Augen- und Haarfarbe sind ebenso gen. Bedingt- auch hier gibt es unterschiede in den Sequenzen. Tödlich ist das aber nicht.

    Bei Inzucht ist eher die geringe gen. Variabilität das Problem, was zu eingeschränkten Reaktionen (einer Population) auf Krankheiten und/oder wechselnde Umweltbedingungen führt. Die von dir erwähnte Sache mit den “schlechten Genkombinationen” ist weniger so wild (nennt sich “purging”).

    Man könnte die Aufgabe noch mehr der Wirklichkeit anpassen, indem man “übliche” Mutationsraten annimmt, wo dann das Produkt noch nicht fertig ist aber dennoch “unpassend” mutiert. Dann wird das vorher Erreichte wieder zerstört. Selbst für die Erfindung eines nur 20 kb großen “weiterführenden” Codes ist dann die Wahrscheinlichkeit praktisch 0. Also irgendwo bei 10^(-1000 * X…..).

    Was soll ein “noch nicht fertiges Produkt sein” welches dann aber “dennoch unpassend” mutieren soll ? Was soll ein “vorher erreichte” sein, was dann “wieder zerstört” wird ?
    Du hast wirklich eine Menge Basiswissen in der Genetik nachzuholen, wenn du schon damit argumentieren willst. Genetik und Evo sind komplizierter, als du es dir vorstellst.
    Was-ist-Was Bd. 111 Gene, wäre ein Anfang- und übrigends, es heisst BP- BasenPaare.

  49. #49 Dr. Webbaer
    8. Dezember 2011

    @Schöner Stein

    Eine “Falsifikation” des Dogmas [der Schöpfung oder der Schöpfungslehre] ist, rein von der Logik her, nicht möglich.

    Sie belegen nur, was der Webbaer weiter oben erklärt hat. Für einen Außenstehenden ist ein Dogma oft, zumindest dieses Dogma mit Sicherheit, eine Theorie. Die christliche Schöpfungstheorie gilt denn auch im Wortsinne als empirisch inadäquat, Papst Pius hat Mitte des letzten Jahrhunderts hier “dogmatische” Anpassungen vorgenommen, die Schöpfungstheorie gilt nun nur noch metaphorisch im Katholizismus.

    Andere in den Staaten, im Bible Belt bspw., haben diese Anpassungen an die Schöpfungstheorie oder die Schöpfungslehre oder -für Sie!- an das Dogma (noch) nicht vorgenommen…

    Man darf die Schöpfungslehre in moderner kreationistischer Form durchaus prüfen, bspw. -siehe oben!- ob es wirklich so ein unglaublicher Zufall ist, wenn 20k Bit Information anscheinend oder besser scheinbar in genau diesem Zustand bereit stehen um einen Job zu erledigen.

    Selbstverständlich neigt Dr. W hier nicht zu Beifall, wenn der Kreationist tätig wird – richtig ist aber auch, dass die kreationistischen Kollegen ihre Fragen loswerden sollen; zudem lebt man ja als Erkenntnissubjekt nicht im Chaos, d.h. Regelmengen werden abgearbeitet und Zustände persistieren sinnhaft, was wiederum heißt, dass ein Kreationismus, der im Pantheismus mündet, vgl. auch Spinoza und Einstein, gar nicht so abwegig ist. Eigentlich sogar zwingend, gerne aber auch ohne -theismus…

    Wir wollen doch den anderen ihre Sichten (Theorien) lassen.

    MFG
    Dr. Webbaer

  50. #50 Donnamara
    8. Dezember 2011

    @Para

    Deine “Evolution” funktioniert nicht, egal mit wie vielen Worten du beschreiben möchtest, wie die einzelnen Buchstaben dieses mittleren Satzteils sich zufällig doch so zusammenfinden konnten, sodaß sie im ganzen Satz einen Sinn ergeben!

    Das ist nämlich das Problem beim evolutionären Hirngespinst. Die Änderungen oder “Mutationen” müssen “passend” sein.

    Bei einigen Merkmalen ist es unerheblich, was da genau steht. Ob die Haare grün, rot, blau oder braun sind, spielt keine nennenswerte Rolle. Aber in anderen Bereichen kommt es genau darauf an, daß alles genau richtig aufeinander abgestimmt ist. Die Mutation vom Maikäfer zum Menschen muß immer dergestalt verlaufen, daß alle erforderlichen Zwischenschritte “richtig” sind. Falls es nicht der Lehrmeinung entspricht, daß aus dem Maikäfer ein Mensch wurde, spielt das prinzipiell keine Rolle. Weil jede Evolutionsmöglichkeit bereits vollkommen ausgeschlossen werden kann.

    Wenn eine zufällige Mutation auftritt, also ein Fehler bei der Übertragung oder Einwirkung ionisierender Strahlung, kann dies an irgendeinem Ort innerhalb des Genoms passieren. An diesem Ort wird dann 1 Basenpaar, welches 4 mögliche Werte annehmen kann, geändert.

    Ob diese Änderung “gut” ist oder schlecht ist, ergibt sich aus dem Zusammenhang, in welchem dieser “Buchstabe” steht. Letztlich muß entsprechend dem mittleren Satzteil des Eingangssatzes dieser Buchstabe bzw. mehrere Buchstabenänderungen das Wort “Buchstabe” an der passenden Stelle stehen, damit der Satz letztlich “funktioniert” oder einen Sinn ergibt.

    Dieser Eingangssatz hat eine Länge von 234 Buchstaben und ein Buchstabe kann, wenn wir das Alphabeth und ein paar Sonderzeichen annehmen, 64 Werte haben. Die Wahrscheinlichkeit daß dieser Satz beim Zusammenwürfeln von 234 Buchstaben diesen Sinn ergibt, beträgt dann 10^( lgt(64) * 234) = 1E ( -422 ). Das Wort “Buchstabe” hat dabei alleine eine Wahrscheinlichkeit von 10^(-18) und die Wahrscheinlichkeit, daß dieses Wort an einer bestimmten Stelle des Satzes auftritt, liegt in diesem Fall bei 1:(234-10), also bei 10^(-2,3). Die Gesamtwahrscheinlichkeit für “Buchstabe” im Satz beträgt hier also 10^(-20,3).

    Wenn der Satz dagegen 10^9 Buchstaben umfasst, liegt alleine die Positionswahrscheinlichkeit bereits bei 10^(-9).

    Wenn das Wort “Bananenmus” statt “Buchstaben” an dieser Stelle stehen würde, ergäbe das Wort selbst zwar einen Sinn, aber nicht mehr der Satz.

    Das Problem der behaupteten zufälligen Mutation ist es nun, während der gesamten Entwicklung vom Maikäfer bis zum Menschen das Genom immer so umgebaut zu bekommen, daß ein funktionierender Sinn herauskommt, und zwar bei jedem einzelnen Schritt!

    Es wird nicht einmal bei obigem einfachen Eingangssatz möglich sein, diesen nach evolutionären Grundsätzen in einen anderen Satz zu verwandeln! Diese Grundsätze behaupten ja immer “kleine Schritte”. Auf den Satz bezogen bedeutet dies dann, nach Änderung eines einzelnen Buchstabens muß der Satz ebenfalls ein richtiger sinnvoller Satz sein.

    Wahrscheinlich wird man es nicht einmal schaffen, durch ganzen Wortaustausch ( es sind 33 Wörter) zu einem sinnvollen nächsten Satz zu gelangen.

    Die Evolution ist eine Absurdität!

    Hier habe ich ein kleines Diagramm erstellt, an welchem sich die Problematik der Evolution durch Zufallsmutation offenbart. Dargestellt sind die Verhältnisse von Lebewesen von 3000 Basenpaaren DNA, entsprechend einem kleinen Virus über 3 Millionen Basenpaare wie bei einem Bakterium bis zu 3 Mrd. Basenpaaren, etwa wie beim Menschen. Es ist dargestellt, wie hoch die Bildungswahrscheinlichkeit für sinnvolle “Wörter” einer bestimmten Basenpaarlänge ist, wenn 10^50 Individuen mit einer bestimmten Mutationsrate mutiert haben. “Sinnvolles Wort” bedeutet jedoch noch lange nicht, daß der Satz sinnvoll ist.

    Alleine die mathematische Wahrscheinlichkeit des menschlichen Genoms liegt bei 10^(-lgt(4)*3*10^9), also bei 10^(-1800 000 000).

    http://imageshack.us/f/259/evolutionswahrscheinlic.png/

  51. #51 Dr. Webbaer
    8. Dezember 2011

    @Donnamara
    Sie leiden an einem unzureichenden Verständnis der Statistik, an Statistikitis.
    Suchen Sie mal an anderer Stellen nach “großer Unwahrscheinlichkeit” – und Sie werden fortlaufend fündig. Alles ist sozusagen extremst unwahrscheinlich. – Gefittet dürfen Sie dann gerne die “Basenpaare” revisitieren.

  52. #52 Para
    8. Dezember 2011

    @Donnamara

    Das ist nämlich das Problem beim evolutionären Hirngespinst. Die Änderungen oder “Mutationen” müssen “passend” sein.

    Wo ist da ein Problem ?

    Bei einigen Merkmalen ist es unerheblich, was da genau steht. Ob die Haare grün, rot, blau oder braun sind, spielt keine nennenswerte Rolle. Aber in anderen Bereichen kommt es genau darauf an, daß alles genau richtig aufeinander abgestimmt ist.

    Bei “einigen” Merkmalen also ? Ahja- bei wie vielen Merkmalen denn genau und welchem Organismus ? Exakte Sequenzen wirst du selten finden, schon allein wegen neutraler Mutationen.

    Die Mutation vom Maikäfer zum Menschen muß immer dergestalt verlaufen, daß alle erforderlichen Zwischenschritte “richtig” sind. Falls es nicht der Lehrmeinung entspricht, daß aus dem Maikäfer ein Mensch wurde, spielt das prinzipiell keine Rolle. Weil jede Evolutionsmöglichkeit bereits vollkommen ausgeschlossen werden kann.

    1.) Blödsinn behaupten der zeigt, dass man keine Ahnung hat und 2.) auch noch behaupten das es egal ist das man keine Ahung hat weil man ja sowieso recht hat ? Geniale Argumentation.

    Dieser Eingangssatz hat eine Länge von 234 Buchstaben und ein Buchstabe kann, wenn wir das Alphabeth und ein paar Sonderzeichen annehmen, 64 Werte haben. Die Wahrscheinlichkeit daß dieser Satz beim Zusammenwürfeln von 234 Buchstaben diesen Sinn ergibt, beträgt dann 10^( lgt(64) * 234) = 1E ( -422 ) …

    Mit solchen Beispielen servierst du jedem der was von Genetik(!) versteht deine Unwissenheit auf dem Silbertablett.
    Es geht schon damit los das du mal wieder von einem “Zusammenwürfeln” fabulierst obwohl ich dir schon vier Mal geschrieben habe das dies mit der Evo nichts zu tun hat. Alle “Wörter” (Aminosäure-Sequenzen) haben nur 3 Buchstaben, von denen jeder gerade mal 4 Zustände annehmen kann und selbst hier können Buchstaben ausgetaucht werden. Darüber hinaus gibt es auch nur “grob” ~20 Wörter (proteinogene Aminosäuren, je nach Organismus mal mehr, mal weniger) die überhaupt benutzt werden. Dann können dieselben Wörten aus verschiedenen Dreierkombinationen entstehen (für Säuger ergeben alle GCx Triplets die Aminosäure Alanin). Das sind jedoch alle gerade mal Grundlagen der Genetik die dir hier fehlen. Mit Evolution hat das alles aber noch gar nichts zu tun, denn dann müsstest du dir noch ein paar Grundlagen in Sachen Populationsökologie aneignen.

    Ist eben alles kompliziert als du es dir wünschst und nur weil du dir Dinge nicht vorstellen kannst, sagt das nichts darüber aus ob etwas auch richtig ist. “DEINE” eigene seltsame Evolutionstheorie ist allerdings tatsächlich Mux. Mit Wahrscheinlichkeiten kann das menschliche Gehirn eh kaum umgehen, wie du selbst sehr schön zeigst.

    P.S. Insekten haben mit Menschen (besser wäre wohl, Wirbeltieren) aus Evo-Sicht herzlichst wenig zu tun.

  53. #53 Dr. Webbaer
    8. Dezember 2011

    Mit Wahrscheinlichkeiten kann das menschliche Gehirn eh kaum umgehen (…)

    Der Mensch navigiert in einer sehr komplexen aus sich heraus oder zumindest für ihn letztlich unverständlichen Umgebung sehr erfolgreich – und zwar basierend auf Näherungen oder “Wahrscheinlichkeiten”. Der Mensch ist sozusagen Experte im Umgang mit Näherungen; dieses Vorgehen ist ihm manchmal, wie Sie und Kollege/Kollegin Donna zeigen, nicht bewusst.

    Zudem ist die Statistik eine Kunst, fürwahr!

  54. #54 Donnamara
    9. Dezember 2011

    “Bei “einigen” Merkmalen also ? Ahja- bei wie vielen Merkmalen denn genau und welchem Organismus ? Exakte Sequenzen wirst du selten finden, schon allein wegen neutraler Mutationen.”

    Das spielt doch gar keine Rolle. Die nichtlethale Merkmalsvariationsbandbreite beim Menschen liegt bei vielleicht 0,1% Unterschied, ist also völlig vernachlässigbar. Der Unterschied zum Affen soll 1,3 % betragen und das ist bereits ein riesiger Unterschied, welcher eine evolutionäre Entwicklung vollkommen ausschließt. Schließlich entspricht dies bereits 40 Mio Basenpaaren. Neuere Untersuchungen lassen sogar auf 5% Unterschied schließen. Aber selbst 1 ppm Unterschied wären bereits nicht mehr machbar.

    “1.) Blödsinn behaupten der zeigt, dass man keine Ahnung hat und 2.) auch noch behaupten das es egal ist das man keine Ahung hat weil man ja sowieso recht hat ?”

    Bei einem blödsinnigen Märchen kann man alles behaupten, was man will. Sogar daß wir uns aus dem Elefanten entwickelt haben oder auch aus der Glühbirne. Ich gebe zu, daß ich dein Märchen nicht extra studiert habe, weil bereits die Anfänge dieses Märchens zu fehlerhaft sind. Ich lese daher auch keine SF Romane und der Elektrojude bleibt auch im Regal.

    “Mit solchen Beispielen servierst du jedem der was von Genetik(!) versteht deine Unwissenheit auf dem Silbertablett.”

    Kein “Genetiker” vermochte es bisher, aus toter Materie Leben zu schaffen. Er vermochte nur Leben zu zerstören. Daher in den Ofen mit diesen Genetikverbrechern! So wie bei Hänsel und Gretel.

    “Es geht schon damit los das du mal wieder von einem “Zusammenwürfeln” fabulierst obwohl ich dir schon vier Mal geschrieben habe das dies mit der Evo nichts zu tun hat.”

    Natürlich hat das mit Zusammenwürfeln zu tun, da bei der “Evolution” der Zufall die “erfindende” Kraft ist. Egal, mit welchem Unsinn du das anders hindrehen willst.

    “Alle “Wörter” (Aminosäure-Sequenzen) haben nur 3 Buchstaben, von denen jeder gerade mal 4 Zustände annehmen kann und selbst hier können Buchstaben ausgetaucht werden.”

    Ob man das Wort “Dummheit” im Binärcode, DNA-Code, Octalcode, Dezimalcode, Hexadezimalcode oder Buchstabencode codiert spielt überhaupt keine Rolle. Gleiches gilt natürlich auch für ein ganzes Wort, welches aus 3 Buchstaben besteht.

    “Darüber hinaus gibt es auch nur “grob” ~20 Wörter (proteinogene Aminosäuren, je nach Organismus mal mehr, mal weniger) die überhaupt benutzt werden. ”

    Nun, unser Alphabet hat auch nur 26 Buchstaben! Die Aufgabe würde auch nicht leichter werden dadurch, daß man nur 2 Buchstaben verwendet. Anscheinend hast du gar keine Ahnung, wovon du sprichst. Sie dir einmal ein Rechnerprogramm an. Da gibt es nur 0 und 1. Und trotzdem beträgt die Wahrscheinlichkeit eine Zeichenfolge entsprechend dem Wort “Dummheit” zufällig zu generieren nur 10^(-19). Dein Rechner braucht dafür rund 100 Jahre.

    ” Das sind jedoch alle gerade mal Grundlagen der Genetik die dir hier fehlen.”

    Du kannst tönen wie du willst, außer Leben zu verpfuschen beherrschst du nichts!

    “Mit Evolution hat das alles aber noch gar nichts zu tun, denn dann müsstest du dir noch ein paar Grundlagen in Sachen Populationsökologie aneignen.”

    Hat “Populationsökologie” etwas mit Evolution zu tun? Dann bedeutet das, daß dies auch ein Märchen ist, welches es niemals gegeben hat.

    ” “DEINE” eigene seltsame Evolutionstheorie ist allerdings tatsächlich Mux.”

    Ach ja? Nur betraf dieser Murx eben genau den Entwickler der Evolution, den Zufall! Da hast du sehr Recht, wenn du das als Murx bezeichnest. Volle Übereinstimmung!

    “P.S. Insekten haben mit Menschen (besser wäre wohl, Wirbeltieren) aus Evo-Sicht herzlichst wenig zu tun.”

    Irrtum. Bienen und ähnliches Getier sind lebensnotwendig, da sie z.B. Pflanzen bestäuben, welche nicht nur unsere Lebensgrundlage sind. Ach so, wir sollen lieber bei Monsanto den Dreck der Genetiker kaufen?

    Ein und derselbe Text in verschiedenen Codierungen:
    ——————
    Binär Code (7-Bit):

    00100011000011110011100000101010001011011
    11111011001101110101110010111100101111110
    11011101111001110010011111101111100111011
    01110000110000010111001100110111000011101
    01110100011101001101110110000010011101110
    10111010011100000101110001001101100100111
    01011101000111001011111001110100111000010

    DNA Code:

    AGAUAAUUAUGAAGGGAGUCUUUCGCGUGGUGCCUGCCUUG
    UCUCUGCUAGCUUGUUGCUCGUGACGAAGUGCGCGUGACUC
    CUCACUCAUCUCGAAGCUCUCCUCAUGAAGUGAGCGUAGCU
    CCUCACUAGUUGCUCAUGAC

    Oktal Code:

    10607470124267754672713627733571623757473
    34140563156072721646730116727234056115447
    2721627635160

    Hexadezimal Code:

    230F382A2DFD9BAE5E5FB779C9FBE76E182E66E1D
    7474DD82775D382E26C9D7472F9D38

    Alphabeth Code:

    Das Evolutionsdogma glauben nur Gläubige!
    ————-
    Erfindungswahrscheinlichkeit für alle Codes = 10^( -86 )

    Es ist völliger Unsinn wenn man glaubt, eine Informationsübermittlung/Informationserfindung würde dadurch leichter, wenn man einen “einfachen” Code verwendet oder die Information in “Worte” unterteilt.

  55. #55 Dr. Webbaer
    9. Dezember 2011

    Ich lese daher auch keine SF Romane und der Elektrojude bleibt auch im Regal.

    Holla. Da schließt sich der Kreis ja fast schon. – Dennoch könnten Sie an den Konzepten ‘Information’, ‘Kodierung’ und “Wahrscheinlichkeit” im Eigeninteresse noch ein wenig arbeiten, noch scheint nicht alles verloren.

  56. #56 Donnamara
    9. Dezember 2011

    @Webbaer
    Kam von dir schon je Brauchbares? Oder begnügst du dich immer nur mit einem Schwafelsatzgenerator, weil das Hirn nicht mehr zuläßt?

  57. #57 Dr. Webbaer
    9. Dezember 2011

    @Donnamara

    Kam von dir schon je Brauchbares?

    Die einen sagen so, die anderen so…

    Dennoch würde der Webbaer es nicht unbegrüsst lassen, wenn Sie freundlicherweise klare Zeichensetzungen aus Ihrem Milieu unterlassen könnten; das Thema Kreationismus ist schon hinreichend belastet und so wie Sie vortragen können auch ernstzunehmende Hinweise und Einwände aus Kreationistenkreisen nur noch schwerlich ernst genommen werden.

    Dabei meint es der Schreiber dieser Zeilen doch nur gut, denn die Frage nach dem Warum ist berechtigt. Dass das Argument mit der Unwahrscheinlichkeit dieses oder jenes Sachverhalts hier als entkräftet aufgefasst wird, haben Sie vielleicht schon mitbekommen, dennoch kann der Kreationismus weiter extrapoliert werden und sich Richtung Spinozas und Einsteins Gott bewegen, bzw. könnte sich dorthin bewegen, wichtig ist das sicherlich nicht wirklich, also nicht wirklich relevant; aber eben doch für den einen oder anderen erörterungswert.

    MFG
    Dr. Webbaer

  58. #58 Donnamara
    9. Dezember 2011

    AAAUUCCGGCGGAUCACUAAUGGCGGCUAACCGGCGACUCGUAACAUCUUUCGUGUAACACAUGC
    CGGCUAACCGCUUACGAGUUUCGUGUAACAGGUGGCGAAGCAAGGCUGACUCCUUACGAGUCACU
    AAUCAUUCAUUAUUUUGAACCUGCAGCUCAUCAUGAAGCACUCAUUGCGUGUAUUUUAUUAUGCC
    UAACACAUGGUGAAGAGCUAGUUACGAGUAACCAGUGUCUCGUGGCGGCUAACAUGUGGUGGCUA
    ACCCGUGCCGCCUAACCCAUGCCGUGUGGCUCGUAACCGCCUACGAGUUGUUAAUCGCUCAUAUC
    UGCUGACGCCUCCUUUAUGGCGUGUGGCGGCUGACGCCUUUCGGCUAUCAAAGUGUUCAUGCCGC
    GUAACACAUGACUGCUAACAAGCGCCGGCUCUCGAAGCUCUAGUUACGAGUAGUGAAGGUCUCAU
    ACCGGCUAACAGUUGGUGCGUAGCUUUCAGUUUUG

  59. #59 cydonia
    9. Dezember 2011

    Es ist nur begrenzt lustig, wenn sich zwei notorische Nichtverstehenwoller zoffen, weil die Ideologien zufälligerweise in einem Punkt differieren. Donnamara ist aber noch um Einiges bornierter, was aber jetzt keinesfalls als Lob der webbÄrschen “Leistungen” missverstanden werden sollte.
    Könntet ihr trotzdem beide die Biege machen, und woanders euer sinnfreies Gesülze posten? Mein Weihnachtswunsch.

  60. #60 Dr. Webbaer
    9. Dezember 2011

    @cydonia
    Naja, Santorum ist ein Rep, dessen Chancen auf die Präsidentschaftskandidatur in etwa denjenigen entsprechen, die Elton auf die Gottschalk-Nachfolge hat, nur damit Sie das mal in Ihre doitsche Perspektive einordnen können – und das war noch sehr freundlich formuliert, also freundlich gegenüber Santorum, nicht gegenüber Elton.

    Dass sich Kommentatorenfreund Donnamara in volksgenössischem Jargon erging, war natürlich bedauerlich und zieht die kommentarische Erörterung des Ganzen letztlich entscheidend herunter, fürwahr!. Dr. W kommt dann auch gerne – sozusagen als Dr. Weihnachtswebbaer, ein HO HO HO! schon mal an dieser Stelle – Ihrem Wunsch entgegen und wird sich ausklinken..,

    MFG + schöne Weihnachtstage schon einmal!
    Dr. Webbaer

  61. #61 buck rogers
    10. Dezember 2011

    @cydonia
    Sehr lustig ist aber dass du eben haargenau das geschrieben hast, was jeder Nicht-Vollhonk hier an dieser Stelle genau nach dem “ACAAGCGCCGGCUCUC…” gedacht hat. Vom ersten bis zum letzten Wort. Hehe.

  62. #62 Donnamara
    11. Dezember 2011

    @cydonia

    “Entweder man trennt sich vom Glauben, oder man hält konsequent an allen Blödsinnigkeiten fest. Alles andere ist Selbstbetrug.”

    Du ziehst also vor, konsequent an allen Blödsinnigkeiten deines Glaubens festzuhalten? Das kann ich sogar verstehen, weil du als Nachkomme deiner äffischen Vorfahren den Selbstbetrug gar nicht erkennen kannst. Nachweislich ist nämlich der IQ von Affen dazu zu gering.

    Du hast mich von deiner Herkunft überzeugt!

    Wo kann ich dich besichtigen und was kostet da der Eintritt?
    So, nun reicht’s langsam. Noch eine solche verbale Entgleisung – Du weißt genau, was ich damit meine, denn die Formulierung war ja absichtlich so beleidend gewählt, also gilt hier kein Unschuldsvorbehalt – und Du hast Dein Privileg, hier Kommentare absetzen zu können, verspielt.

  63. #63 Donnamara
    11. Dezember 2011

    Das war’s dann. Auf Nimmerwiedersehen!

  64. #64 BreitSide
    12. Dezember 2011

    Autsch, wenn man einmal nicht genauer hinsieht…

    Schade, dass dieser Fred mich nicht benachrichtigt. Wenn ich nur wüsste, woran das liegt? Naja, geht auch mit Lesezeichen, aber mühsam…-(

    Aber die gequrirlten Exkremente von DonnaWetta und WebBarsch hab ich nicht wirklich vermisst.

    Tapfer, cydonia, dass Du diesem Mist die Stirn bietest!

  65. #65 Para
    12. Dezember 2011

    @Donnamara

    also nochmal (evtl. ja sogar das lette Mal, wie es scheint)

    Das spielt doch gar keine Rolle. Die nichtlethale Merkmalsvariationsbandbreite beim Menschen liegt bei vielleicht 0,1% Unterschied, ist also völlig vernachlässigbar.

    Was soll eine “nichtlethale Merkmalsvariatiosbreite” sein ? Und woher die 0.1 % ? Was du vielleicht meinen könntest(!) wäre die Anzahl lethalter Genkombinationen beim Menschen die jedoch unbekannt ist da für eine solche Zahl die Funktion und Rekombination aller Proteine bekannt sein muss (was nicht der Fall ist).

    Der Unterschied zum Affen soll 1,3 % betragen und das ist bereits ein riesiger Unterschied, welcher eine evolutionäre Entwicklung vollkommen ausschließt. Schließlich entspricht dies bereits 40 Mio Basenpaaren. Neuere Untersuchungen lassen sogar auf 5% Unterschied schließen. Aber selbst 1 ppm Unterschied wären bereits nicht mehr machbar.

    1.) Éin “Affe” ist kein Tier, sondern beschreibt eine Tiergruppe. Damit sind dann auch noch alle Alt-Weltaffen gemeint exklusive(!) Menschenaffen. “Menschenaffen” wäre da wohl der passendere Begriff, jedoch gibt es selbst hier noch ein paar Arten.
    2.) Die 1.3% eine evolutionäre Entwicklung ausschließt ist Blödsinn (Quelle?) die Unterschiede in regionalen Populationen kann auch mal gut um die 25% betragen (z.B. Haase et al. , 2003 bei Schnecken). Genetische. Distanzen haben viele Ursachen, “Bottleneck” ist wohl die belkannteste.

    Ich gebe zu, daß ich dein Märchen nicht extra studiert habe

    Das alles sind noch Grundlagen der Genetik und haben mit der Evo noch gar nichts zu tun.

    Kein “Genetiker” vermochte es bisher, aus toter Materie Leben zu schaffen.

    Genetik ist was anderes als Evolutionsbiologie ist etwas anderes als die Biogenese (Entstehung des Lebens).

    Natürlich hat das mit Zusammenwürfeln zu tun, da bei der “Evolution” der Zufall die “erfindende” Kraft ist. Egal, mit welchem Unsinn du das anders hindrehen willst.

    Zum Fünften Mal, nein. Nur bereits Vorhandenes wird verändert. Es ensteht nichts komplett “neues” aus dem “nichst”.

    Irrtum. Bienen und ähnliches Getier sind lebensnotwendig, da sie z.B. Pflanzen bestäuben, welche nicht nur unsere Lebensgrundlage sind. Ach so, wir sollen lieber bei Monsanto den Dreck der Genetiker kaufen?

    Was hat das mit der Evo i.S.v. der Absatmmungslehre zu tun ? Richtig, nichts.
    Zum Code-Beispiel. Du übersetzt einen Alphabetcode in einen beliebig anderen Code und willst damit was zeigen ? Das Beispiel ist nach wie vor Unsinn da es nichts mit der Evo zu tun hat. Zum sechsten Mal, es entsteht nicht eine komplett neue codierende Sequenz aus dem nichts. 26 Buchsatben vs. ~ 20 Wörter (mit fixierter Länge) ist zudem ein enormer Unterschied. Mit 26 Buchstaben kann man praktisch unendliche viele Wörter (verschiedener Längen) generieren. Wenn es allerdings nur ~20 Wörter gibt, von denen viele sogar auf verschiedene Weise codiert sind ist die Kombination sowie Änderung stark bergenzt. Abgesehen davon haben ähnliche Merkmale in verschiedenen Arten sehr ähnliche Gensequenzen, man nehme nur Insulinpräparate von Schwein, Rind und Mensch. Ebenso, zum wiederholten Mal. Gensequenzen sind keine exakte Aneinanderreihung von Basenpaaren, sondern es sind unterbrochenene Sequenzen, wobei die Unterbrechungen (=Introns) variabel in der Länge sind. Ein Gen mit 100 BP kann dieselbe Information wie ein Gen mit 300 BP liefern.
    Das alles ist jedoch Basiswissen der Genetik und hat mit der Evolutionstheorie noch immer nichts zu tun. Wenn du die Evo wirklich in Frage stellen willst, dann mach das doch bitte nicht über die Genetik. Dafür mangelt es dir zuviel an Basiswissen.