Over 180 readers have commented on my recent blog articles about the Tengri 137 mystery. Now Tengri 137 has posted a new challenge.

For years, Cicada 3301 was the most important internet mystery game. To date nobody knows who was behind the series of puzzles and cryptograms that showed up in 2012, 2013, and 2014 (each series started in January). However, in January 2015 and 2017 nothing new was detected, and I’m still not sure whether the challenges published in January 2016 are genuine. Meanwhile I’m afraid that Cicada 3301 is dead.

 

Tengri 137

September 16, 2016, marked the start of a new internet mystery game (thanks to Bernhard Esslinger for the hint). On this day an unknown person using the pseudonym Tengri 137 twittered a link to an encrypted book. Pages 1 to 16 of this book were already solved, when I first heard about it. The solution is available at the Tengri 137 Wikia. In an ingenious act of codebreaking blog reader Klaus Tappeiner from South Tyrol decrypted pages 17 to 22. I wrote about his success in a recent blog post.

The last page of the Tengri 137 book is still unsolved. Here it is:

P023

On March 14, which is known as Pi Day among mathematicians, Tengri 137 published another tweet. This one led to the following PGP-signed message:

B U R U M U T R E F A M T U
N U R E S U T R E G U M F A
Y A P S U A Z B E H I M L A
Z A N R U A Z B E N O M B A
T O B I K O T L U B U M Y O
S U N O K U R G A N O Z Y I
O K U Z I K U F A U S I H E
Y A B E K A N S A B E R H O
N A F E R A N S A H O T F E
K O R E M O R B I Z U M R O
S U N A K I R F A N E M B A

Nothing is random.

2, 8, 20, 28, 50, 82, ...

http://bit.ly/2mUF7Xy

Tengri 137
0x666ab731

The link given in this message leads to a sound file in MP3 format. My readers Norbert, nimrodx0, Alex, and Klaus found out that this file contains the following hidden messages:

LITTLE BIRD KNOWS WHEN THE GATE IS OPEN END END END
666666m7x6x5regc.onion

The letter sequence “B U R U M U T…” contained in the signed message is, as far as I understand it, an intermediate result that appears when one decodes the hidden text in the sound file. It is probably meant to be a confirmation that one is on the right track. “666666m7x6x5regc.onion” is a Tor network address that currently doesn’t lead to anything. Maybe we have to wait until “the gate is open”, i. e., somebody fills the page with content.

 

The latest Tengri 137 message

Yesterday another Tengri 137 tweet was published (thanks to Karin Isberg and Klaus Tappeiner for the hint). Again it led to a signed message.  Here it is:

NOTHING IS RANDOM

U T M A F E R T U M U R U B
A F M U G E R T U S E R U N
A L M I H E B Z A U S P A Y
A B M O N E B Z A U R N A Z
O Y M U B U L T O K I B O T
I Y Z O N A G R U K O N U S
E H I S U A F U K I Z U K O
O H R E B A S N A K E B A Y
E F T O H A S N A R E F A N
O R N U Z I B R O M E R O K
A B M E N A F R I K A N U S

1 / 2 / Auf einer Seite lesen

Kommentare (19)

  1. #1 Thomas
    30. März 2017

    The new posted reversal of BURUTREFAMTU yields also the “SNAKEBAY” (Australia)

  2. #2 Arminius
    31. März 2017

    A few observations about the letter cube to work with:
    – It’s a reversal of the previous cube.
    – Every column has either only vowels or only consonants (with only one exception).
    – There is a lot of letter repetition in the same column.
    – Some columns are almost identical.
    – The sequence “NOTHING IS RANDOM” is now written in caps and is almost exactly as long as one row. Maybe they want to clarify that it’s a key for something.

  3. #3 Arminius
    31. März 2017

    A few more observations:
    – The letters C D J Q V W X don’t appear at all (which is plausible for an English text).
    – It’s not an exact reversal. The second to last line ends with “M R O” in the first message but in the second one it starts with “O R N”. (That means only the first 137 letters from message one are the same.)

  4. #4 Arminius
    31. März 2017

    Never mind, turns out people have already been working on the cube with better results than me. I just couldn’t find this in the Wiki. 🙂 It’s in the comments here: http://scienceblogs.de/klausis-krypto-kolumne/2017/03/08/how-a-blog-reader-solved-the-tengri-137-mystery/

  5. #5 anniusverus
    1. April 2017

    Go back to the PGP key 0x666ab731 that was created one month after his first pi day tweet, 15:09 2016-03-14. It appears not to be random. Any thoughts on that from the crypto community ? https://en.wikipedia.org/wiki/Post-quantum_cryptography

  6. #6 anniusverus
    1. April 2017

    The creation date can be faked by setting system clock to desired time.

  7. #7 Arminius
    1. April 2017

    Wild theory:
    The letter cube contains a timestamp that reveals when the Tor address becomes available.

    We have seen a single letter change in the new cube because we missed the first timestamp and the friendly aliens decided to encode the next possible time when the “gate is open”.

    Since the cube is 14 characters long it could encode a date like 2017/04/01-23:59:59 which would be exactly 14 digits.

  8. #8 kud gt
    1. April 2017

    Nice theory, Arminius.
    To proof it, we only have to wait, nothing to do and after the next open zyclus there will be another similiar birdsong vor the new opening. 😉

    I agree:
    We miss hints in the older releases​. I guess, more than one time.
    “Nothing ist random” included “There’s more than one way to skin a cat.”

  9. #9 tomtoo
    2. April 2017

    Relax. It could take months to reformat the brain.
    ; )

  10. #10 Alex
    3. April 2017

    The gate was open: https://www.reddit.com/r/tengri137/comments/631vcd/new_tweet_the_gate_is_open_now_for_few_moments/

    Comment from Reddit User /u/tikitembo7 :

    I reuploadet both files on Pastebin with the correct formating!

    * The gate is open now = https://pastebin.com/P59Kf0cs
    * nothingisrandom.txt = https://pastebin.com/u7pFiCpD
    * themessage.txt = https://pastebin.com/BcMucDVh
    * Screenshot of the page: http://imgur.com/a/FoIi5 (Date and Time -> PI / 2017-03-14 15:09) :)))

    All 3 PGP signatures (as before /u/NimrodX0 said) are correct!!!

  11. #11 Thomas
    3. April 2017

    New post:

    —–BEGIN PGP SIGNED MESSAGE—–
    Hash: SHA256
     
    We said;
     
    “NOTHING IS RANDOM”
    … and nothing was random.
     
    “ONLY READING THE MESSAGE, IS NOT TO UNDERSTANDING IT”
    … and many individuals read the message but few found the secret behind our texts. Few claimed we are governments. These are on a false path.
     
    “IMPORTANT CONTENT NEEDS TO BE HIDDEN”
    … important content was hidden and is still hidden for all others. Only few know the date and time of our final step!
     
    and we said;
     
    “ALL OTHERS THEY GET THE HELP OF OTHERS, WILL FAIL MISERABLY”
    … and they fail miserably! All others were distracted by unimportant details. Few recognized the truth!
     
    “THIS OBJECT IS NOT DESIGNED FOR A COLLECTIVE OR A TOOL”
    … they used the collective mind and tools but not their own brain!
     
    “ONLY ONE SOUL WILL REACH ITS DESTINATION”
    … many individuals can pass the first steps until end but one individual can reach its destination.
     
    “WHO HAS THE CORRECT GENETIC CODING WILL UNDERSTAND THIS TEXT”
    … they understood it.
     
    “HIGHLY COMPRESSED DATA IN YOUR BRAIN”
    … literally it was so.
     
    “B U R U M U T R E F A M T U”
    … the first sequence repeated by many individuals. The coded knowledge is unpacked. We got from few individuals the first signals.
     
    we said again;
     
    “NOTHING IS RANDOM”
    … and nothing was random.
     
    “U T M A F E R T U M U R U B”
    … the second sequence distributed. Verification is complete. First individuals connected.
     
    We are pleased to see that this important line is still alive until this day. So many progeny.
     
    Next step:
    3151
     
    601010109301050107020303030201002010101010101010102020999910099100109910010990101099000009995004000300400309400204001030030040010100000100000100000100000998098099910980000009400000995004004000300307090400104003000200101000001000001000001000009980600909200960500910000005006000009100940808050600707004006091003040096002009400304009004006070608050700803080080309070507070709300900800903000101009207095050000093040100010201001006020002020000000100040005001000901050001002060105000000206010500605001009998000509500010103010101010102000901010109701095000009700000000093000700090092007001090100500200700200403010501030403020302030803010309304040930909502010920000200000102000099950101030309010400950010100100200900100010010010910000000000000960100209304000093000000000000009995030303091040004091092091040104091030101030603020202020302030103030103020020040400200300105050100500606007005050090003030009300010100090100505001030200103030100202020202000202020200000002010200000004000400040005000007020104010001040401060009200060104010102010601020101010201060102010101020106010601020105001001000000010010099992000000060000000008040900000000600000000995030070007020101000020102000100010101050102020010020204010100020002000203020010701002030200020002000101040202001002020105010101000100020102000010102070007003099500000000600000000904080000000006000000099999500209030200302060010100200406000100040504000040300102040000100001000010000997
     
    Now solve themessage.txt

    —————————
    The message:
     
    MYVZZJCKTBWKOWUWZOCZMPJHWHFATRZVLFNCLQIDRUVFMTAYMJUKERRTWRWEPHPWASDZYHFWBULFKYPRFJRGBHYWHLPTLCITLSXAQHRCUQFYUIESOERZBMYUGZXAOLBIMXQQWFYITOTJMAXNPFYEGSFVVRJTCRLDJTTPLCGGZIAYJVKYJIVRRVYAYRJZANQKZSEJUVJQXTOXPNAWZICWPRIQGMJPXZNXRMKRUVWTGJASYWNEUXTTDVRUKNERPNSQFPIODZUMHIEEMSVTEKDAECVHYOGAZRJJPGCWBEANVCWCZNYIAUEITITDKZLUACWLSIKIBPRPRATDPTKXTIWTPVUGRCDYNZHFNWIUIZEAXSZICSIYBNRZPPKGYIPQDQEOQXLGLEJQBHYWIQAYLVKVAYSYRLXHWUFCLJNQJSJFCQPWZMKXOUZQSWXBRCDYNZHFCGKXHDOCJIVRCFRORCDNDEGBUCWQPHKHQXCMROIBKLSQVZMKSIXGSWQCROIBKLSQSWSSIXPDGSOCSJJMVHTBHQBCHDOCBDBOWCMAAREQUOEWAPJEIJZAPUXKQASGCDPWPKMHWJKCNRSJNCSYTEMDESHSZMKXOUZQACDTIKUYQFMEHIEGKGNCAEZFGMVXRUUOABOIZHSOAQAORCHOSUFRANLKKAGYLFMQPHYGNZXBZTQXDSRAVYTGZHTPDPSIUWQQQORHHNDVNSBBSSZIZNCPHDKSGZVSUOVNTOFYYWEENSVXSSEMUZSRLZPRQDNYICBSTCKHYYBWDNTTFNEIIZEAHNDVNSBBXLLBKECUMFXOUZSRCAWCPFYEXQTIRDYYLVFTUMJJTQEFRAEWWPZYHWOTSUBSVYTWNBMGNPSYTEMDQFMEGMJCSZLQHCEWRCHOBNZFCDVINMXBSAOSKWAAKIFPABIYZBFFWATHNNZRMPEYRZXXFYFJBAYNZELVUYBLYIPQDQEOPVWKMUTSEXDNUJVIMKJXJVKYIRJITVALDMENSHWAEFHQTCUFJZAAXDJHGCXCCZCOQMGURQJRKLZONUFNKNPLYQWYKNHASSBDCJOSJVNSKZTUSAJIYAESSBJQOTPCYLGDQHRCUQFYOWUWQOBCYUOOLYQNKDPTTLBZGEIGWFYIDIMSRRTXRQOSQQDYFGNLSQQULSQYDMAMDSNSWHDUPOKZXZOAVDATZOCZWUFCFHJYAUEIFLDQHMSKWIZRCYAEBZEWXQNLGAAMLOESNKHEFHJYQXPGDSNSKPXWXAMPTGPZKAHQCGZBTEEMKBEWHJGBJWWFAYSYRLXHCRAINUEFYENQTRMDMCRBFFQOVWNWRAZCVEWTSKPJYIPQDQEOTIWTJSJFMZNSDGQIVEWTSKPJYIPQDQEOCWUEHVHALDNFENFNEUTVPXHATRZVGCBMOELFUNZQXQOWURSCYWXPJSJFUGNJTLBZOQMWBJEAHFXGYASUFTXJLVKVAYSYRLXHHZKRDMEFRMUIHLPTMWLRCYAESPFMUICGSPICENFNYJMUPTKXZCCMUXVPIFJSVKALNKIDRBRDNQWHEPMEASNYYOUYZQBSDPQAYUUWPYVNROFUVYTGZHTPPFYEXQNLGAAMLOESXSZIVLXFHHLWPIGHQSOIGVDKFZDZYOREQFMEUSIWWIYUNAIOSQCOKIWNXSZILIKVAYSYRLXHAJZFWELXHFOMMWBACSIYMTDXDHDRFCBRESMHWCMALQOWZHBTYXWCBLNSANMUOZLVLLTNBOOAIMBBIYFYJSJFZMKXOUZQTBFRAYFAGNZXMBTKZMKXOUZQMOLTNVTTHYONCDPWKQFMMYNOCCLFURYMVHTBEZVYRAEWHQDQBJXXMNTAZCVWFVBXVNXXGFAYFOPFKLSQSHTHAJUCYJTWZCVWGQVZIZQKIYHBCKXDEMDRGAVVAAHPPSYEXCJHDPPEMKUCDGUEFOEQQNSEAVICQNGWRHVFLMAWPFYESKHUEGLHRBXLCWJTKNLECSIYGOXOVHAHPNAWCBSOUTMGZOYGYIPQDQEOBFVZQXUNEAMMFFHBWFYIQCPKUULWTRKETXVTEGXGKPDNEHZHILJKYRNXONPHOTFPQRWQOKBYXCIZZKRSPFYEFHJYKUXXSCGIFGLYEHBOKULRHDOMEORTUTDMQKDQTLBZOQMWDOENENFNEUTVWIJMPUNLLWIBUNGYEALSXDFMLYQNDMEFKFLCMWJLRYHAFKSLNBUWEUTVZOSEZVHAXYVQFIACOURADIPBOCASHTJYJNNJCWUUGUTAIKJRQSOIBFRJWLHDNPKAMUVBQQXNWGJBPFYEUZDOGLXQMSPFHSHNXJPHWOTYLHXVRFYNSKHUCFZEKPBJKQQIVRPMFDGKCUJGSOECBPKTQSZDUZSRYGDDMABHQYIADQCXHNCQDIJODVLNGXLDRMYPZFCISSNCTKLDLCUVMCJITXMOAYJNJSJFIDCUPFYEKFLCMWJLWZDKBBPRRUJCYDTUXQYEHTUOMLOHXBXTXYOSULHIRSOSNVHLGJHCSLIUEFHQZYFZYXNBIVAAEJJOFDPBFOPFKLSQSHTHCZIGMVCFZWIFCBMQYJDKAINIFTLRLUWYHRXDWOFMZACPFTICVXVZAYWEQURPCCLFABXZZJCKFYMLKOWAMLLGIJYMZCVWFVBXVNXXLQKWCVNVDZLBUXIOYPNYBSOYANMUBZEWMPCXMPNECSBYOWUWQOBCYUOOHDOMQQDYFGNLKWQCBNQPZMAJUOTCKKNGCFZEPRZKOQPYBBPRVJZTCZCODDWKDSNSWHDUPOKZENZCMKJXJVKYQDNYHWOMJSJFTLBZGEIGCNXMFLSVXFCMRVJMSYCCTQFNQJRAMBTKTRZVMTCGEJJOPVTHGWBIVXAIXYEZJSJFUGNJTLBZDTAAYDMKTLFPJTHBBBGDTQSABCHUUYXMZREQQIJDASDZOWUWJEFNKOZZRMWCEJTZPFYENZFZIRJIBBGDTQSAJXWMEATAPVRPCFRMPIWDKTBPAEJYOKHCBWRBAWPWGVAGCMFWMDAEUGKSAYFAJWEKYLNHXBXTXYOSOWWKCGVOYYZOCFWZKCLTQHREFFBXGPXWXBNEHEMRMSOQTIWTFHJYFJRLWIYUMFHRZCCXUVYAOAJXTEMDWZXRYNGQHFZOCWCASAPSYUOOWWISLSQYCSHCUZRMXVWNTVANWBTAYAFMKUDQIJKWOKAAJZAATPKWCCLFQJRANYJUVFWQSWBHPGVSFIACPIWAEORTLMFUXRNPEKUEBDCKQNSEODCEZGDXYHVVBTLGIGOUSDDGTEMDTIWTPVUGNAHCBGDKDQPGIFXQJPWAOLIEDGGOAQDOBZVTZEHSRYKHMLRRHMSKWIZRCYAEWEZPEGFVFGSUHQEGSIIWRYHAQYXWCZDQOVWIWHTZOCAUJCKQTEMDJZZIYLGDEZLCLVCHWFYIPLIGYGIOGPYLXWVGOFDSLDCRCRJUDETKNZFZVEJICSWGABXZJLUEBGDKEFCGZSSMMTDXXBXTXYOSUPTITJCWKAZCINTTDPRDAYFAPIRPQNLOFDGKZYGMBYFCCJOSHFZOBRPVQGRUMLAWLZBZLDSMFUIKKFRAGZIYNCFOEOZZOAFWHQBCHJTFZGQOUYXMZREQBCHUWFHMOMPEZNVJPFYENZFZIRJIVYBPXTTMALTKIPLULBZDZZXDLEPBTIFDJTZNOOJUBDSGWGXRFAIRSNBJTSBODFVRNMYZELYVANMULMFUDMFFDQDPQDNYWHTZOCAUKLPRSIXGNKHERNJWGMDDUIFWZMDSPIJQQASGFESRRSOSBWRYBRCINBPNDZBHYGLJEORTTSVQVEJGXHAYFLSVMTKOTYMAPFYEKBEWKXHBDBQSHBDOZGDXKDPTZMKXOUZQEODZCKXDOWUWZRXMOQPYINDWWFHMMLSWQHXFEFTGRZIYMPJIWWISGLWQNCXDWRKIAHCORFYNHQEGURYMEORTTTRJRIYDOWUWUYXMZREQMTKPYEDOTQSATPDHRLHDAQSWMSOQMQKAXBSMMTAKHHXASUFREHZHOGQGWHTZOCAULXZWLIVQANMUWUTZOCAUEALSEXHFMKGGVUQQOKZFRHVFEHKYTEMDLFPGYIRXQENGYYBWQSDMAYFAJNREDIJOEZLCCIHUYUOOWJKCNRSJADAORIGEBDDTBXHCDTXNZAQGAHDGGZCKZEEQSMUUQENGCVGUJTXBVUQQXRXXRHVFLIYWBQPLDPPCQDNYMXGGDKCYRSRZFDBJNSBBXVNJFZDZBNTULXWMPWMOPRIQXIXWEGRYVAKRIXZQMXGGDIMSLVDLCDPWNVLVKZXICIHUYUOOUVJQKLTLHASHGVMUDVTFVYBPHNRKNCFONWSHNXUJIBYKUYQYNVHLUVJQZUAUAKISJISETADBHDBVLUWYTLBZDTAAQNSEOPMMDPJSSIKIZCCXXZRKOEPVCLLZTPKWEGAEMOLTZCCMGFOCFFXWPPVBIOYKIHQOKWYKWKQWEWWCDVLNRZTHHZXQVZACKGNCFTZTFOPFJTFKQWZZDQPGEPMEEIMIMWLRCYAEARBGQKDQYAQGIOFCRILTUYHHZSEJQFOKSYPBCYJASUTHWMJMBDNVMKJXJVKYWZDKJTLQYKNBQGPSRCWKRYECRBDZJOVMXCZEAYUSAPJEIJZAPUXKIOOQXAPBBOSQQMFSBTGEFQODULTFCFROVYLCCDPWFNJANTNVMCJIZGDXJEHRSFHYYIUYXLHDZJLHPOKZGAOULYJVTHQCDSNSLHXQNVVDGDNGNUEZDRUHYRAQGQSUKAHQXHKWLFNRRHVFVHXWCESCOSVZAAMKKVADCSBVDFVRPFLPUBZFENRFBBOAFKSLEFYNHDOCTLBZWVRGYXDMMOPEXWPXOHACDKJAFYDQOQPYPUXKCKIIOSPMPGFZZFHDAIRHBHOIVWNWTIWTGGYEZMKXOUZQDTJXCBKZDZSGJZHHUYHHAMHHDTFPFLAWTEMDYKIQBQVIXUATMCRXRSARGORCXRCUVVVPEHYQUULWZWYLDYMGOWOCAKPTDOILORHOLQQPWATHRRYMUYXMZREQDAMCJVIIMDTKNJTZBAHBZMKXOUZQJPZJUVYAHOLPQGTEJSUNBCHUEFPGSEDNXNFABFRJIOPGOWUWJCLUWELXPFWGWWISRQOSZXBQCHGKSTKGAUAGLSNCNZHFNWIUIZEAPPZXQGOSFPBDRHKAXOCQXQNLGAAMLOESQASGHUGVCNXDXHLFNIWRKLSQVCIBOIBMPNQVPSKNQLKMMDTIEBZVVCIBOIBMBBGDYAFMQASGNQWHNPWSEKYUVITSESXFQASGMVCFXHLFNIWRKLSQLMPRZSEJHKDIQBOIPUMMJRDIUMCIVOHSZEIYAWZFFMUGIJMATQULTOSURVMIGKAKTEMDGKLKMTKPRXYUVVVPXUVRQGPSXPOJDKCYYVFGQOLUOZLVLLTNMFSUBBPLXPAMGGPBTQEFRAEWKXTAKKNDMVNMUZIWNYWVPWOFSILVDPRDNKHEOVLPNIWRZAQGZEUMEANYUWUUKLPRCIJWNVFUXWVGEKAATPKNGQZLENGCQKDQYIRXFCABOXYYEKXKCAPBQGFGVTNXUVJQLSEQQTBGYBXEALOIPSEDKDOWWZQIBJEATIWTXLLBKECUIXTWEWUMXJPHWOTYYUXVSCGIFGLYMGCGEJJOZJHXPMHPPTSOROYWYIPQDQEOPUXKQXZUTIUGRTMWIRJIEPNVKFRAYNEILYUMQNSEODCEGDNGSYRNDPESBDSGTDNZRUESRHVFKMTICGHUCXLYCZCOQJHILBVUYCRZDMMXDOZBMUWYAFAMENZCXJPHWOTYYUXVTNNHZFOGOJRXVCIBOIBMESMHXSZIWYWKAQXPLYJVSFHYYMSUKXTSDOVHKLJOEOCUGGYEUAIQKDOWCVGUHUXDOEESVYYIAGNIDEIZKDPGQGCYQPMWKSMYPAPYDPESILJKKDQIXLLBWWISQHEMOSXTKFRAYNEIWQNENHMMYFOSMNTAQUGAMPOUOFAITIFDHSPSDBQSTDMTQLKMHBGULPAUIKWCCVDMWWISGUKMZEEQCGHUCXLYXZUMZOSEBCHUKNKBBAVEUBLWPXOKOVGWSRJLCYJAEOQMSPQGAPJEOFPMTDPZVWLZLMTSLFNRXCJHZUSOCCLFVCIBOIBMCNDVWODCOJUWQASGTOFYGJHCSLIUSTKGQSIMSOECSKUJQQRXCHGKRZXXDIRFGDXTKPXMKDPGOGQCCSOQYHGSTIWTPFYEZQBSDPQADPSIBFRJIOPGDRJPUJLQAHXUYBRFCDVOEOXRCHGKKDOWCVGUSADCBMYYXOMZEUZUSDTXTAAZECVHBBVLUEWYAHXUYBRFXCZEIZQKIQAYUXYKADAOPLIGVCIBOIBMIFDRZACPWOPAIXPDJDKYLYQNNZBRQXUNYKNBMIHGDQHFZEEQJNBBLGAJDGRLUZMVKAWK

  12. #12 Thomas
    3. April 2017

    Sorry, this is only the beginning of the message. Can´t post the complete message (6448 letters!)

  13. #13 Anonymous
    3. April 2017

    Prime factors of 3151 is 23 and 137 and the long number is not a prime.

  14. #14 Norbert
    4. April 2017

    Abo

  15. #15 citizenone
    4. April 2017
  16. #16 hattadone
    4. April 2017

    Picking up the genentic code idea for the UTMAFERTUMURUB cube, one could replace the letters with the number of different Codons resulting in a certain amino acid. This would be a one-to-one relation.

    This could also be applied for the Letters B and Z, just adding the different options.

    Anyway the result doesn’t look very promising to me:

    14142264111614
    42114264162612
    46132246416442
    44112246416246
    12114164123414
    32612446121216
    22361421236121
    12624462422442
    22412462462242
    16216346112612
    44122426324216

  17. #17 tomtoo
    6. April 2017

    I know that some if the readers in here know around 10^9 more about cypers than i know. Why the readers give not somthing back ? Let’s see if the “Aliens” can decypher the message ? ; )

  18. #18 Brad
    Canada
    7. April 2017

    My research:

    Nucleodie has only one base… can be any
    Bases bond in in the center of the dna molecule
    Chargoff’s Rule states that A always bonds to T with double bonds and G always bonds to C with triple bonds (A=T, G~=C)
    The sequence of the nitrogen bases is the ‘code’ of DNA
    the DNA sequence on one strand of dna tells you the sequence of the other: ATGCAAGGCC bonds to TACGTTCCGA (other side of dna)

    Describes building of proteins
    RNA is the message, with a template that is sent to the rhibosone for manufacture into a proteins

    Transcription DNA -> mRNA
    When transcribing to mRNA you change all the T (Thymine) bases to U (Uracil) bases

    CCR5 gene analysis A 190-bp segment of the CCR5 gene was amplified from genomic DNA by polymerase chain reaction (PCR) amplification using 5′ GGTGGCTGTGTTTGCGTCTCT 3′ and 5′ GATTCCCGAGTAGCAGATGACCAT 3′ forward and reverse primers. The reaction mixture comprised final concentrations of 16 mmol/l of ammonium sulphate, 67 mmol/l of Tris-HCl (pH 8·8), 0·01% of Tween 20, 1·5 mmol/l of MgCl2 and 0·125 mmol/l of dNTPs, to which was added 12·5 pmoles of each primer in a final volume of 25 μl. PCR conditions were: initial denaturation 93°C for 5 min; 40 cycles 93° for 30 sec, 55° for 30 sec, 72°C for 30 sec; final extension 72°C for 10 min. The samples obtained from the PCR reaction were electrophoresed on a 2·5% agarose gel and bands visualized by ethidium-bromide staining and UV transillumination. The 32-bp-deleted CCR5 mutant yielded a 158-bp band in contrast with the wild-type 190-bp fragment.

    THIS IS THE TARGET MUTATION CHROMOSOME PROTEIN PATTERN

    source: https://pastebin.com/JpbgD7Yh
    HERE IS THE TRANSLATOR FROM mRNA (template) to DNA and reverse. This will verify the message.

    http://www.fr33.net/translator.php

    Homo sapiens chromosome 3, GRCh38.p7 Primary Assembly DNA MUTATION (THIS IS THE TARGET)
    Here is the mRNA for the CCR5-D32 genome (see above for the DNA).

    mdyqvsspiy dinyytsepc qkinvkqiaa rllpplyslv fifgfvgnml vililinckr
    lksmtdiyll nlaisdlffl ltvpfwahya aaqwdfgntm cqlltglyfi gffsgiffii
    lltidrylav vhavfalkar tvtfgvvtsv itwvvavfas lpgiiftrsq keglhytcss
    hfpysqyqfw knfqtlkivi lglvlpllvm vicysgilkt llrcrnekkr hravrlifti
    mivyflfwap ynivlllntf qeffglnncs ssnrldqamq vtetlgmthc cinpiiyafv
    gekfrnyllv ffqkhiakrf ckccsifqqe aperassvyt rstgeqeisv gl

    here is the genome, in full, where I did the DEL (delete).

    cttcagatag attatatctg gagtgaagaa tcctgccacc
    tatgtatctg gcatagtgtg agtcctcata aatgcttact ggtttgaagg gcaacaaaat
    agtgaacaga gtgaaaatcc ccactaagat cctgggtcca gaaaaagatg ggaaacctgt
    ttagctcacc cgtgagccca tagttaaaac tctttagaca acaggttgtt tccgtttaca
    gagaacaata atattgggtg gtgagcatct gtgtgggggt tggggtggga taggggatac
    ggggagagtg gagaaaaagg ggacacaggg ttaatgtgaa gtccaggatc cccctctaca
    tttaaagttg gtttaagttg gctttaatta atagcaactc ttaagataat cagaattttc
    ttaacctttt agccttactg ttgaaaagcc ctgtgatctt gtacaaatca tttgcttctt
    ggatagtaat ttcttttact aaaatgtggg cttttgacta gatgaatgta aatgttcttc
    tagctctgat atcctttatt ctttatattt tctaacagat tctgtgtagt gggatgagca
    gagaacaaaa acaaaataat ccagtgagaa aagcccgtaa ataaaccttc agaccagaga
    tctattctct agcttatttt aagctcaact taaaaagaag aactgttctc tgattctttt
    cgccttcaat acacttaatg atttaactcc accctccttc aaaagaaaca gcatttccta
    cttttatact gtctatatga ttgatttgca cagctcatct ggccagaaga gctgagacat
    ccgttcccct acaagaaact ctccccggta agtaacctct cagctgcttg gcctgttagt
    tagcttctga gatgagtaaa agactttaca ggaaacccat agaagacatt tggcaaacac
    caagtgctca tacaattatc ttaaaatata atctttaaga taaggaaagg gtcacagttt
    ggaatgagtt tcagacggtt ataacatcaa agatacaaaa catgattgtg agtgaaagac
    tttaaaggga gcaatagtat tttaataact aacaatcctt acctctcaaa agaaagattt
    gcagagagat gagtcttagc tgaaatcttg aaatcttatc ttctgctaag gagaactaaa
    ccctctccag tgagatgcct tctgaatatg tgcccacaag aagttgtgtc taagtctggt
    tctctttttt ctttttcctc cagacaagag ggaagcctaa aaatggtcaa aattaatatt
    aaattacaaa cgccaaataa aattttcctc taatatatca gtttcatggc acagttagta
    tataattctt tatggttcaa aattaaaaat gagcttttct aggggcttct ctcagctgcc
    tagtctaagg tgcagggagt ttgagactca cagggtttaa taagagaaaa ttctcagcta
    gagcagctga acttaaatag actaggcaag acagctggtt ataagactaa actacccaga
    atgcatgaca ttcatctgtg gtggcagacg aaacattttt tattatatta tttcttgggt
    atgtatgaca actcttaatt gtggcaactc agaaactaca aacacaaact tcacagaaaa
    tgtgaggatt ttacaattgg ctgttgtcat ctatgacctt ccctgggact tgggcacccg
    gccatttcac tctgactaca tcatgtcacc aaacatctga tggtcttgcc ttttaattct
    cttttcgagg actgagaggg agggtagcat ggtagttaag agtgcaggct tcccgcattc
    aaaatcggtt gcttactagc tgtgtggctt tgagcaagtt actcaccctc tctgtgcttc
    aaggtccttg tctgcaaaat gtgaaaaata tttcctgcct cataaggttg ccctaaggat
    taaatgaatg aatgggtatg atgcttagaa cagtgattgg catccagtat gtgccctcga
    ggcctcttaa ttattactgg cttgctcata gtgcatgttc tttgtgggct aactctagcg
    tcaataaaaa tgttaagact gagttgcagc cgggcatggt ggctcatgcc tgtaatccca
    gcattctagg aggctgaggc aggaggatcg cttgagccca ggagttcgag accagcctgg
    gcaacatagt gtgatcttgt atctataaaa ataaacaaaa ttagcttggt gtggtggcgc
    ctgtagtccc cagccacttg gaggggtgag gtgagaggat tgcttgagcc cgggatggtc
    caggctgcag tgagccatga tcgtgccact gcactccagc ctgggcgaca gagtgagacc
    ctgtctcaca acaacaacaa caacaacaaa aaggctgagc tgcaccatgc ttgacccagt
    ttcttaaaat tgttgtcaaa gcttcattca ctccatggtg ctatagagca caagatttta
    tttggtgaga tggtgctttc atgaattccc ccaacagagc caagctctcc atctagtgga
    cagggaagct agcagcaaac cttcccttca ctacaaaact tcattgcttg gccaaaaaga
    gagttaattc aatgtagaca tctatgtagg caattaaaaa cctattgatg tataaaacag
    tttgcattca tggagggcaa ctaaatacat tctaggactt tataaaagat cactttttat
    ttatgcacag ggtggaacaa gatggattat caagtgtcaa gtccaatcta tgacatcaat
    tattatacat cggagccctg ccaaaaaatc aatgtgaagc aaatcgcagc ccgcctcctg
    cctccgctct actcactggt gttcatcttt ggttttgtgg gcaacatgct ggtcatcctc
    atcctgataa actgcaaaag gctgaagagc atgactgaca tctacctgct caacctggcc
    atctctgacc tgtttttcct tcttactgtc cccttctggg ctcactatgc tgccgcccag
    tgggactttg gaaatacaat gtgtcaactc ttgacagggc tctattttat aggcttcttc
    tctggaatct tcttcatcat cctcctgaca atcgataggt acctggctgt cgtccatgct
    gtgtttgctt taaaagccag gacggtcacc tttggggtgg tgacaagtgt gatcacttgg
    gtggtggctg tgtttgcgtc tctcccagga atcatcttta ccagatctca aaaagaaggt
    cttcattaca cctgcagctc tcattttcca tacagtcagt atcaatat cttggggctg gtcctgccgc tgcttgtcat ggtcatctgc
    tactcgggaa tcctaaaaac tctgcttcgg tgtcgaaatg agaagaagag gcacagggct
    gtgaggctta tcttcaccat catgattgtt tattttctct tctgggctcc ctacaacatt
    gtccttctcc tgaacacctt ccaggaattc tttggcctga ataattgcag tagctctaac
    aggttggacc aagctatgca ggtgacagag actcttggga tgacgcactg ctgcatcaac
    cccatcatct atgcctttgt cggggagaag ttcagaaact acctcttagt cttcttccaa
    aagcacattg ccaaacgctt ctgcaaatgc tgttctattt tccagcaaga ggctcccgag
    cgagcaagct cagtttacac ccgatccact ggggagcagg aaatatctgt gggcttgtga
    cacggactca agtgggctgg tgacccagtc agagttgtgc acatggctta gttttcatac
    acagcctggg ctgggggtgg ggtgggagag gtctttttta aaaggaagtt actgttatag
    agggtctaag attcatccat ttatttggca tctgtttaaa gtagattaga tcttttaagc
    ccatcaatta tagaaagcca aatcaaaata tgttgatgaa aaatagcaac ctttttatct
    ccccttcaca tgcatcaagt tattgacaaa ctctcccttc actccgaaag ttccttatgt
    atatttaaaa gaaagcctca gagaattgct gattcttgag tttagtgatc tgaacagaaa
    taccaaaatt atttcagaaa tgtacaactt tttacctagt acaaggcaac atataggttg
    taaatgtgtt taaaacaggt ctttgtcttg ctatggggag aaaagacatg aatatgatta
    gtaaagaaat gacacttttc atgtgtgatt tcccctccaa ggtatggtta ataagtttca
    ctgacttaga accaggcgag agacttgtgg cctgggagag ctggggaagc ttcttaaatg
    agaaggaatt tgagttggat catctattgc tggcaaagac agaagcctca ctgcaagcac
    tgcatgggca agcttggctg tagaaggaga cagagctggt tgggaagaca tggggaggaa
    ggacaaggct agatcatgaa gaaccttgac ggcattgctc cgtctaagtc atgagctgag
    cagggagatc ctggttggtg ttgcagaagg tttactctgt ggccaaagga gggtcaggaa
    ggatgagcat ttagggcaag gagaccacca acagccctca ggtcagggtg aggatggcct
    ctgctaagct caaggcgtga ggatgggaag gagggaggta ttcgtaagga tgggaaggag
    ggaggtattc gtgcagcata tgaggatgca gagtcagcag aactggggtg gatttgggtt
    ggaagtgagg gtcagagagg agtcagagag aatccctagt cttcaagcag attggagaaa
    cccttgaaaa gacatcaagc acagaaggag gaggaggagg tttaggtcaa gaagaagatg
    gattggtgta aaaggatggg tctggtttgc agagcttgaa cacagtctca cccagactcc
    aggctgtctt tcactgaatg cttctgactt catagatttc cttcccatcc cagctgaaat
    actgaggggt ctccaggagg agactagatt tatgaataca cgaggtatga ggtctaggaa
    catacttcag ctcacacatg agatctaggt gaggattgat tacctagtag tcatttcatg
    ggttgttggg aggattctat gaggcaacca caggcagcat ttagcacata ctacacattc
    aataagcatc aaactcttag ttactcattc agggatagca ctgagcaaag cattgagcaa
    aggggtccca tagaggtgag ggaagcctga aaaactaaga tgctgcctgc ccagtgcaca
    caagtgtagg tatcattttc tgcatttaac cgtcaatagg caaagggggg aagggacata
    ttcatttgga aataagctgc cttgagcctt aaaacccaca aaagtacaat ttaccagcct
    ccgtatttca gactgaatgg gggtgggggg ggcgccttag gtacttattc cagatgcctt
    ctccagacaa accagaagca acagaaaaaa tcgtctctcc ctccctttga aatgaatata
    ccccttagtg tttgggtata ttcatttcaa agggagagag agaggttttt ttctgttctg
    tctcatatga ttgtgcacat acttgagact gttttgaatt tgggggatgg ctaaaaccat
    catagtacag gtaaggtgag ggaatagtaa gtggtgagaa ctactcaggg aatgaaggtg
    tcagaataat aagaggtgct actgactttc tcagcctctg aatatgaacg gtgagcattg
    tggctgtcag caggaagcaa cgaagggaaa tgtctttcct tttgctctta agttgtggag
    agtgcaacag tagcatagga ccctaccctc tgggccaagt caaagacatt ctgacatctt
    agtatttgca tattcttatg tatgtgaaag ttacaaattg cttgaaagaa aatatgcatc
    taataaaaaa caccttctaa aataa

    Here is a PASTEBIN I found, to verify the data, appears to be placed purposefully

    https://www.ncbi.nlm.nih.gov/gene?Db=gene&Cmd=DetailsSearch&Term=1234%5Buid%5D
    https://www.ncbi.nlm.nih.gov/nuccore/NG_012637.1
    https://www.ncbi.nlm.nih.gov/protein/4502639

    >NG_012637~1:571-11065 Homo sapiens C-C motiF chemokine recep tor .5(~e/pseuclogene) (CCR5)~ ReFSeqGen e on chromosome 3

    FOR DELTA 32 OF THIS GENOME

    CTTCAGATAGATTATATCTGGAGTGAAGAATCCTGCCACCTATGTATCTGGCATAGTGTGAGTCCTCATA
    AATGCTTACTGGTTTGAAGGGCAACAAAATAGTGAACAGAGTGAAAATCCCCACTAAGATCCTGGGTCCA
    GAAAAAGATGGGAAACCTGTTTAGCTCACCCGTGAGCCCATAGTTAAAACTCTTTAGACAACAGGTTGTT
    TCCGTTTACAGAGAACAATAATATTGGGTGGTGAGCATCTGTGTGGGGGTTGGGGTGGGATAGGGGATAC
    GGGGAGAGTGGAGAAAAAGGGGACACAGGGTTAATGTGAAGTCCAGGATCCCCCTCTACATTTAAAGTTG
    GTTTAAGTTGGCTTTAATTAATAGCAACTCTTAAGATAATCAGAATTTTCTTAACCTTTTAGCCTTACTG
    TTGAAAAGCCCTGTGATCTTGTACAAATCATTTGCTTCTTGGATAGTAATTTCTTTTACTAAAATGTGGG
    CTTTTGACTAGATGAATGTAAATGTTCTTCTAGCTCTGATATCCTTTATTCTTTATATTTTCTAACAGAT
    TCTGTGTAGTGGGATGAGCAGAGAACAAAAACAAAATAATCCAGTGAGAAAAGCCCGTAAATAAACCTTC
    AGACCAGAGATCTATTCTCTAGCTTATTTTAAGCTCAACTTAAAAAGAAGAACTGTTCTCTGATTCTTTT
    CGCCTTCAATACACTTAATGATTTAACTCCACCCTCCTTCAAAAGAAACAGCATTTCCTACTTTTATACT
    GTCTATATGATTGATTTGCACAGCTCATCTGGCCAGAAGAGCTGAGACATCCGTTCCCCTACAAGAAACT
    CTCCCCGGTAAGTAACCTCTCAGCTGCTTGGCCTGTTAGTTAGCTTCTGAGATGAGTAAAAGACTTTACA
    GGAAACCCATAGAAGACATTTGGCAAACACCAAGTGCTCATACAATTATCTTAAAATATAATCTTTAAGA
    TAAGGAAAGGGTCACAGTTTGGAATGAGTTTCAGACGGTTATAACATCAAAGATACAAAACATGATTGTG
    AGTGAAAGACTTTAAAGGGAGCAATAGTATTTTAATAACTAACAATCCTTACCTCTCAAAAGAAAGATTT
    GCAGAGAGATGAGTCTTAGCTGAAATCTTGAAATCTTATCTTCTGCTAAGGAGAACTAAACCCTCTCCAG
    TGAGATGCCTTCTGAATATGTGCCCACAAGAAGTTGTGTCTAAGTCTGGTTCTCTTTTTTCTTTTTCCTC
    CAGACAAGAGGGAAGCCTAAAAATGGTCAAAATTAATATTAAATTACAAACGCCAAATAAAATTTTCCTC
    TAATATATCAGTTTCATGGCACAGTTAGTATATAATTCTTTATGGTTCAAAATTAAAAATGAGCTTTTCT
    AGGGGCTTCTCTCAGCTGCCTAGTCTAAGGTGCAGGGAGTTTGAGACTCACAGGGTTTAATAAGAGAAAA
    TTCTCAGCTAGAGCAGCTGAACTTAAATAGACTAGGCAAGACAGCTGGTTATAAGACTAAACTACCCAGA
    ATGCATGACATTCATCTGTGGTGGCAGACGAAACATTTTTTATTATATTATTTCTTGGGTATGTATGACA
    ACTCTTAATTGTGGCAACTCAGAAACTACAAACACAAACTTCACAGAAAATGTGAGGATTTTACAATTGG
    CTGTTGTCATCTATGACCTTCCCTGGGACTTGGGCACCCGGCCATTTCACTCTGACTACATCATGTCACC
    AAACATCTGATGGTCTTGCCTTTTAATTCTCTTTTCGAGGACTGAGAGGGAGGGTAGCATGGTAGTTAAG
    AGTGCAGGCTTCCCGCATTCAAAATCGGTTGCTTACTAGCTGTGTGGCTTTGAGCAAGTTACTCACCCTC
    TCTGTGCTTCAAGGTCCTTGTCTGCAAAATGTGAAAAATATTTCCTGCCTCATAAGGTTGCCCTAAGGAT
    TAAATGAATGAATGGGTATGATGCTTAGAACAGTGATTGGCATCCAGTATGTGCCCTCGAGGCCTCTTAA
    TTATTACTGGCTTGCTCATAGTGCATGTTCTTTGTGGGCTAACTCTAGCGTCAATAAAAATGTTAAGACT
    GAGTTGCAGCCGGGCATGGTGGCTCATGCCTGTAATCCCAGCATTCTAGGAGGCTGAGGCAGGAGGATCG
    CTTGAGCCCAGGAGTTCGAGACCAGCCTGGGCAACATAGTGTGATCTTGTATCTATAAAAATAAACAAAA
    TTAGCTTGGTGTGGTGGCGCCTGTAGTCCCCAGCCACTTGGAGGGGTGAGGTGAGAGGATTGCTTGAGCC
    CGGGATGGTCCAGGCTGCAGTGAGCCATGATCGTGCCACTGCACTCCAGCCTGGGCGACAGAGTGAGACC
    CTGTCTCACAACAACAACAACAACAACAAAAAGGCTGAGCTGCACCATGCTTGACCCAGTTTCTTAAAAT
    TGTTGTCAAAGCTTCATTCACTCCATGGTGCTATAGAGCACAAGATTTTATTTGGTGAGATGGTGCTTTC
    ATGAATTCCCCCAACAGAGCCAAGCTCTCCATCTAGTGGACAGGGAAGCTAGCAGCAAACCTTCCCTTCA
    CTACAAAACTTCATTGCTTGGCCAAAAAGAGAGTTAATTCAATGTAGACATCTATGTAGGCAATTAAAAA
    CCTATTGATGTATAAAACAGTTTGCATTCATGGAGGGCAACTAAATACATTCTAGGACTTTATAAAAGAT
    CACTTTTTATTTATGCACAGGGTGGAACAAG

    ///Homo sapiens chromosome 3, GRCh38.p7 Primary Assembly///

    ATGGATTATCAAGTGTCAAGTCCAATCTATGACATCAAT
    TATTATACATCGGAGCCCTGCCAAAAAATCAATGTGAAGCAAATCGCAGCCCGCCTCCTGCCTCCGCTCT
    ACTCACTGGTGTTCATCTTTGGTTTTGTGGGCAACATGCTGGTCATCCTCATCCTGATAAACTGCAAAAG
    GCTGAAGAGCATGACTGACATCTACCTGCTCAACCTGGCCATCTCTGACCTGTTTTTCCTTCTTACTGTC
    CCCTTCTGGGCTCACTATGCTGCCGCCCAGTGGGACTTTGGAAATACAATGTGTCAACTCTTGACAGGGC
    TCTATTTTATAGGCTTCTTCTCTGGAATCTTCTTCATCATCCTCCTGACAATCGATAGGTACCTGGCTGT
    CGTCCATGCTGTGTTTGCTTTAAAAGCCAGGACGGTCACCTTTGGGGTGGTGACAAGTGTGATCACTTGG
    GTGGTGGCTGTGTTTGCGTCTCTCCCAGGAATCATCTTTACCAGATCTCAAAAAGAAGGTCTTCATTACA
    CCTGCAGCTCTCATTTTCCATACAGTCAGTATCAATTCTGGAAGAATTTCCAGACATTAAAGATAGTCAT
    CTTGGGGCTGGTCCTGCCGCTGCTTGTCATGGTCATCTGCTACTCGGGAATCCTAAAAACTCTGCTTCGG
    TGTCGAAATGAGAAGAAGAGGCACAGGGCTGTGAGGCTTATCTTCACCATCATGATTGTTTATTTTCTCT
    TCTGGGCTCCCTACAACATTGTCCTTCTCCTGAACACCTTCCAGGAATTCTTTGGCCTGAATAATTGCAG
    TAGCTCTAACAGGTTGGACCAAGCTATGCAGGTGACAGAGACTCTTGGGATGACGCACTGCTGCATCAAC
    CCCATCATCTATGCCTTTGTCGGGGAGAAGTTCAGAAACTACCTCTTAGTCTTCTTCCAAAAGCACATTG
    CCAAACGCTTCTGCAAATGCTGTTCTATTTTCCAGCAAGAGGCTCCCGAGCGAGCAAGCTCAGTTTACAC
    CCGATCCACTGGGGAGCAGGAAATATCTGTGGGCTTGTGA

    /// ///

    CACGGACTCAAGTGGGCTGGTGACCCAGTC
    AGAGTTGTGCACATGGCTTAGTTTTCATACACAGCCTGGGCTGGGGGTGGGGTGGGAGAGGTCTTTTTTA
    AAAGGAAGTTACTGTTATAGAGGGTCTAAGATTCATCCATTTATTTGGCATCTGTTTAAAGTAGATTAGA
    TCTTTTAAGCCCATCAATTATAGAAAGCCAAATCAAAATATGTTGATGAAAAATAGCAACCTTTTTATCT
    CCCCTTCACATGCATCAAGTTATTGACAAACTCTCCCTTCACTCCGAAAGTTCCTTATGTATATTTAAAA
    GAAAGCCTCAGAGAATTGCTGATTCTTGAGTTTAGTGATCTGAACAGAAATACCAAAATTATTTCAGAAA
    TGTACAACTTTTTACCTAGTACAAGGCAACATATAGGTTGTAAATGTGTTTAAAACAGGTCTTTGTCTTG
    CTATGGGGAGAAAAGACATGAATATGATTAGTAAAGAAATGACACTTTTCATGTGTGATTTCCCCTCCAA
    GGTATGGTTAATAAGTTTCACTGACTTAGAACCAGGCGAGAGACTTGTGGCCTGGGAGAGCTGGGGAAGC
    TTCTTAAATGAGAAGGAATTTGAGTTGGATCATCTATTGCTGGCAAAGACAGAAGCCTCACTGCAAGCAC
    TGCATGGGCAAGCTTGGCTGTAGAAGGAGACAGAGCTGGTTGGGAAGACATGGGGAGGAAGGACAAGGCT
    AGATCATGAAGAACCTTGACGGCATTGCTCCGTCTAAGTCATGAGCTGAGCAGGGAGATCCTGGTTGGTG
    TTGCAGAAGGTTTACTCTGTGGCCAAAGGAGGGTCAGGAAGGATGAGCATTTAGGGCAAGGAGACCACCA
    ACAGCCCTCAGGTCAGGGTGAGGATGGCCTCTGCTAAGCTCAAGGCGTGAGGATGGGAAGGAGGGAGGTA
    TTCGTAAGGATGGGAAGGAGGGAGGTATTCGTGCAGCATATGAGGATGCAGAGTCAGCAGAACTGGGGTG
    GATTTGGGTTGGAAGTGAGGGTCAGAGAGGAGTCAGAGAGAATCCCTAGTCTTCAAGCAGATTGGAGAAA
    CCCTTGAAAAGACATCAAGCACAGAAGGAGGAGGAGGAGGTTTAGGTCAAGAAGAAGATGGATTGGTGTA
    AAAGGATGGGTCTGGTTTGCAGAGCTTGAACACAGTCTCACCCAGACTCCAGGCTGTCTTTCACTGAATG
    CTTCTGACTTCATAGATTTCCTTCCCATCCCAGCTGAAATACTGAGGGGTCTCCAGGAGGAGACTAGATT
    TATGAATACACGAGGTATGAGGTCTAGGAACATACTTCAGCTCACACATGAGATCTAGGTGAGGATTGAT
    TACCTAGTAGTCATTTCATGGGTTGTTGGGAGGATTCTATGAGGCAACCACAGGCAGCATTTAGCACATA
    CTACACATTCAATAAGCATCAAACTCTTAGTTACTCATTCAGGGATAGCACTGAGCAAAGCATTGAGCAA
    AGGGGTCCCATAGAGGTGAGGGAAGCCTGAAAAACTAAGATGCTGCCTGCCCAGTGCACACAAGTGTAGG
    TATCATTTTCTGCATTTAACCGTCAATAGGCAAAGGGGGGAAGGGACATATTCATTTGGAAATAAGCTGC
    CTTGAGCCTTAAAACCCACAAAAGTACAATTTACCAGCCTCCGTATTTCAGACTGAATGGGGGTGGGGGG
    GGCGCCTTAGGTACTTATTCCAGATGCCTTCTCCAGACAAACCAGAAGCAACAGAAAAAATCGTCTCTCC
    CTCCCTTTGAAATGAATATACCCCTTAGTGTTTGGGTATATTCATTTCAAAGGGAGAGAGAGAGGTTTTT
    TTCTGTTCTGTCTCATATGATTGTGCACATACTTGAGACTGTTTTGAATTTGGGGGATGGCTAAAACCAT
    CATAGTACAGGTAAGGTGAGGGAATAGTAAGTGGTGAGAACTACTCAGGGAATGAAGGTGTCAGAATAAT
    AAGAGGTGCTACTGACTTTCTCAGCCTCTGAATATGAACGGTGAGCATTGTGGCTGTCAGCAGGAAGCAA
    CGAAGGGAAATGTCTTTCCTTTTGCTCTTAAGTTGTGGAGAGTGCAACAGTAGCATAGGACCCTACCCTC
    TGGGCCAAGTCAAAGACATTCTGACATCTTAGTATTTGCATATTCTTATGTATGTGAAAGTTACAAA