Klaus-Tappeiner-Tengri-137

“Who can solve this encrypted book?”, I asked five weeks ago. Blog reader Klaus Tappeiner from South Tyrol, Italy, could. His solution of the Tengri 137 cryptogram is absolutely ingenious.

On January 29th this year I reported on the Tengri 137 mystery. Tengri 137 is an encrypted book anonymously published in August 2016. Here’s a PDF for download.

 

The mystery

The Tenri 137 book has 23 pages. The following figure shows page 7:

P007

The purpose of Tengri 137 is unclear. It might be an internet game similar to Cicada 3301.

Pages 1 to 16 of Tengri 137 were already solved, when I published my first article about this mystery. The solution is available in the Tengri 137 Wikia. However, pages 17 to 23 are different from the 16 first ones. Their meaning was unknown until recently. Here they are:

P017 P018

P019 P020

P021 P022

P023

These last seven pages of the Tengri 137 book contain long multiplications and divisions. Do they encode a message? If yes, what kind of code is used? All these questions remained unanswered.

The solution

A few days ago, a blog reader named Klaus Tappeiner, who wasn’t known to me, posted the following solution (it contains a line provided by Norbert Biermann):

Page 17
TIME FOR THE TRUTH
OVER MANY THOUSAND YEARS WE SEND YOU MESSENGERS AND TEACHER
ALL THIS KNOWLEDGE BEHIND YOUR CIVILISATION IS OURS
WE ARE THE DESIGNERS OF MANY CIVILISATIONS
YOUR CIVILISATION IS ONE OF MANY BILLION CIVILISATIONS
THE MANKIND IS DESIGNED TO RECIEVE OUR THOUGHT
SOME GENIUS IDEA YOU HAVE ARE OURS
WE CAN HEAR YOUR THOUGHT
WE KNOW YOUR NEEDS
WE CAN LET YOU SEE THINGS
WE CAN LET YOU MAKE THINGS
WE CAN GIVE YOU THOUGHTS
YOU LEARN IN INTERACTION WITH US
WE CALL SOME OF THE CHOSEN ONES THE MESSENGERS
THIS MESSENGERS ARE OUR REPRESENTATIVES
WE SEND YOU OUR WORD AND KNOWLEDGE OVER THIS MESSENGERS

Page 18
THE REARE PEOPLE AMONG YOU
THESE PEOPLE DO NOT UNDERSTAND THE MEANING OF OUR INTERVENTION
WE PREPARE YOU FOR THOUSANDS OF YEARS FOR THIS MEETING
THOSE WHO HAVE UNDERSTOOD EVERYTHING CORRECTLY
HAVE USED OUR KNOWLEDGE WELL
OTHERS WHO HAVE NOT UNDERSTOOD ANYTHING HAVE MADE US GODS
THESE ARE DANGEROUS IN THEIR THOUGHTS AND ACTION
KEEP DISTANCE
SUCH WE DO NOT WANT TO HAVE AMONG US
WE ARE NOT YOUR GODS
YOU SHOULD KNOW THAT GOD DOES NOT EXIST
EVERYTHING THAT EXISTS IS BASED ON AMATHEMA
NOTHING MORE AND NOTHING LESS
DO NOT BELIEVE IN ANY GOD
BEWARE FROM THOSE WHO CALLS THEMSELVES GODS
THOSE ARE EVIL

Page 19
ANOTHER TRUTH
A CALCULATION THAT CAN NOT BE REVIEWED BY YOU
DOES NOT MEAN THAT THERE IS NO ANSWER
A BORDER THAT YOU CANNOT SEE
DOES NOT MEAN THAT IT DOES NOT EXIST
SOMETHING THAT YOU CAN NOT MEASURE
DOES NOT MEAN THAT IT IS UNMEASURABLE
IF YOU ALWAYS WOULD GO STRAIGHT FOR WAR
WHICH SEEMS TO BE ENDLESS
YOU WOULD BE ABLE TO PROVE AT SOME POINT
THAT THIS GARDEN HAS A FENCE
EVEN IF YOU TRY TO PROVE THAT THIS GARDEN HAS NO FENCE
YOU WOULD INEVITABLY PROVE THE CONTRARY

Page 20
YOUR MEASUREMENT IS ONLY VALID WITH AN EXACT RESULT
THE MEASURMENT OF AN INFINITE GARDEN CAN NOT BROUGHT TO AN END BY YOU
YOU HAVE NOT THE TOOLS AND YOU HAVE NOT THE TIME
NOT THE LIFESPAN OF AN HUMAN WE MEAN THE LIFESPAN OF YOUR UNIVERSE
THE INFINITY OF THIS GARDEN WOULD BE ONLY A GUESS NOT A FACT
WHO TRY TO PROVE THE INFINITY PROVE AT END THE OPPOSITE
THIS IS INEVITABLE (+?)
OUR CIVILIZATION EXISTS SINCE THREE BILLION OF YOUR EARTH YEARS
WE ARE BEINGS FROM ANOTHER GALAXY
WE ARE IN YOUR GALAXY FOR OVER FIFTY MILLION YEARS AND
CONTACTED OVER HUNDRED THOUSAND DIFFERENT SPECIES
THE SEARCH FOR THE LIMITS OF THE UNIVERSE IS OVER
THE UNIVERSE IS VERY LARGE BUT NOT INFINITE
THERE LIVE MANY OTHER SPECIES SUCH YOURS
MANY OF THESE CIVILIZATIONS COULD REACH THE NEXT STAGE
YOUR CIVILISATION HAS REACHED THE CRITICAL LIMIT
IF YOU DO NOT MAKE THE NEXT STEP IN YOUR EVOLUTION
YOU WILL DESTROY YOURSELVES
MANY CIVILIZATIONS FAIL (+?)

1 / 2 / 3 / Auf einer Seite lesen

Kommentare (151)

  1. #1 BE
    8. März 2017

    Diese Lösung ist richtig kreativ! Congratulation.

  2. #2 Carsten
    Dresden
    8. März 2017

    Great Solution. :))

    I think I can reproduce the ciphering easily. Here is a little example:

    7×149×5881×7237
    —————————
    2×81163×1203361

    Did I get it right? Can you decipher it?
    I hope not to blame. 😀

    Regards.
    Carsten

  3. #3 Thomas
    8. März 2017

    There is a mistake in the Tengri wikia because they name a Reddit user adam 31415 as the decrypter of this part: http://tengri137.wikia.com/wiki/Tengri_137_Translation

  4. #4 Klaus
    8. März 2017

    @Thomas
    I posted the result also on tengri137.wikia.com under the reddit user name adam31415.
    If necessary I can post something there with this user name (unfortunately not the answer for the last page…)

  5. #5 norbert
    Graz
    8. März 2017

    Fine solution!
    How to construct such calculations: I think this could be done with a method for clock-making. the clock makers former days had to use rational approximations with teeth wheels. compare here: http://www.americanscientist.org/issues/pub/on-the-teeth-of-wheels/1
    or
    http://www.ams.org/samplings/feature-column/fcarc-stern-brocot

  6. #6 tomtoo
    9. März 2017

    WoW !

  7. #7 Thomas
    9. März 2017

    There are algorithms for fraction approximation that are based on the Stern-Brocot-tree (see norbert #5) or chained fractions ( A tool: http://www.mindspring.com/~alanh/fracs.html.) But I don’t see yet how the search can be limited to fractions with (prime) factorizable numerators and denominators.

  8. #8 Bernhard Gruber
    9. März 2017

    Amazing story and great solution!

  9. #9 norbert
    Graz
    9. März 2017

    @thomas #7. I remember one can easily search for “near-by”-solutions (with preferable characteristics). I used to play a bit with the clock-makers-problem, but that has been years ago…

  10. #10 Marc
    9. März 2017

    @Klaus :
    congratulation, great job !!!

    @Carsten #2 :
    solution: THIS IS A TEST

  11. #11 Carsten
    9. März 2017

    @Marc: No suprise: This is correct. Wolfram Alpha did the mathematical part. This is done very fastly.

  12. #12 Jim
    9. März 2017

    On page 18 the word “amathema” is incomplete. It should be “a mathematical truth”.
    63 23 63 45 70 43 80 77 93 32 43 72 13 22 63 54 77 16 43 16 77 16 56 13 16 63 105 76 11 13 12 13 22 80 63 12 13 43 77 17 13 57 22 37 92 22 72
    e v e r y t h i n g t h a t e x i s t s i s b a s e d o n a m a t h e m a t i c a l t r u t h

  13. #13 Jim
    10. März 2017

    Page 23 translated the same way looks to me like a natural language rather than a cipher. Anybody know Amharic? Some of the words appear related to places in Ethiopia or Facebook pages for Ethiopians.

  14. #14 tomtoo
    10. März 2017

    Page 23
    Just a first tought.
    Gen-encodet . Could be 4 Letters as Group.
    The first 8 letter give 2 words that realy exist.

  15. #15 Norbert
    10. März 2017

    Speaking of page 23: I recently posted an incorrect translation in which 114 is assigned to U instead of F (Flerovium), due to a bug in the geocaching (!) tool used. Unfortunately, they posted my wrong version also on Tengri wikia (including my typo “alternativ”, hihi …) but kindly enough, they do also suggest a correct version of line 9. Here is the updated rectangle:

    B U R U M U T R E F A M T U
    N U R E S U T R E G U M F A
    Y A P S U A Z B E H I M L A
    Z A N R U A Z B E N O M B A
    T O B I K O T L U B U M Y O
    S U N O K U R G A N O Z Y I
    O K U Z I K U F A U S I H E
    Y A B E K A N S A B E R H O
    N A F E R A N S A H O T F E
    K O R E M O R B I Z U M R O
    S U N A K I R F A N E M B A

    Except for line 7, columns 2, 6, 9, 11 and 14 contain solely vowels and columns 1, 3, 7, 8, 10, 12, 13 solely consonants (regarding Y as such). I wouldn’t be surprised if the encoding had something to do with vowels and consonants (five nucleobases – five vowels).

  16. #16 tomtoo
    13. März 2017

    Hi Norbert,

    utre,azbe,anza repeat.
    What do you think ? What could that tell about the code ?

  17. #17 tomtoo
    13. März 2017

    @Norbert

    Sry ansa. What are the longest combinations that repeat ?
    And could it tell something about the code ?

  18. #18 Norbert
    13. März 2017

    @tomtoo
    Gute und richtige Frage. Wenn ich darauf eine kluge Antwort wüsste, hätte ich’s vermutlich schon gelöst :-)

    Letztlich gibt es ja noch nicht einmal eine Garantie, dass die Anwendung des Periodensystem-Codes nach numerischer Berechnung der Brüche auf Seite 23 auch wirklich ein Schritt zur Lösung ist. Es erscheint nur folgerichtig bzw. man hat den Eindruck, dass die Macher des Rätsels uns durch die vorhergehenden Seiten in diese Richtung stoßen wollten. Immerhin bietet der Periodensystem-Ansatz eine Erklärung für das Problem, auf das Jim hingewiesen hatte: Der neunte Bruch ergibt eine 30-stellige Periode, alle anderen dagegen eine 28-stellige. Da man aber hier zwei dreistellige Ordnungszahlen herauslesen kann (und überall sonst nur zweistellige), wird alles schön gleichförmig: 11 Zeilen à 14 Buchstaben.

    Man kann nur herumprobieren – und möglichst alle Hinweise einsammeln, die von den Rätselmachern hinterlassen wurden. Dazu zählen die abgebildeten fünf Nukleinsäuren und vor allem der von Klaus entzifferte abgefahrene Text (z.B. könnten “genetically encrypted”, “this texts contains the unique key”, “repeat it often never break in the middle” Hinweise für die Entschlüsselung sein).

    Eine rein gefühlsmäßige Einschätzung: Die Autoren scheinen in gewisser Weise Eindruck schinden zu wollen (“wie kommt man denn auf so tolle magische Quadrate?” etc.). Der letzte Lösungsschritt müsste demnach auch den größten Wow-Effekt haben.

  19. #19 Steve
    13. März 2017

    Interesting stuff around here.
    As I read about the Fleissner Challenge and keeping tengri in mind, I thought You guys should take look at it that way.
    That Hill Climbing algorithm stuff with orbits. I question myself, cause I´m no good programmer, how the genetik stuff could fit in.

    Line 1,2 have UT bonding, which is like an error. than there is the UA bonding in Line 3,4 shifted one space to the left. Line 5 looks like the pole point of U: Line 1 to 4 / Coloumn 9= E,E,E,E then line 5 U, then Line 6 to 9 = A,A,A,A. All vowels except O, the lost middle, frequenz
    -> OM – UM. Line 4 to 6:
    ZANRUAZB E N OM BA
    TOBIKOTL U B UM YO
    SUNOKURG A N OZ YI

    Column 12 with its 5 Lines of M , ending in the last two lines again with M. Inbetween M to N shift, N Lines 8,9 in Coloumn 7:
    Y A B E K ANSA BERHO
    N A F E R ANSA HOTFE
    Is this a guide for standing and changing letters?
    Line 6,7 is in U shift before the pole:
    S U NOK U RGANOZYI
    OK U Z IK U FAUSIHE
    –> U Kik U (take that out):
    SUN ORGAN O Z Y I
    O K U Z F A U S I H E

    Maybe the lost word (Keyword) to find or to integrate or whatever, is ZEBRA. I kinda see it everywhere ^.^

    Also 6,6,6 seen as E,E,E or A,A,A in corresponding way. Line 2 to 4 Coloumn 14 = A,A,A. Line 8 to 10 Coloumn 4 = E,E,E.

    “You float like a feather
    In a beautiful world
    I wish I was special
    You’re so fuckin’ special

    But I’m a creep
    I’m a weirdo
    What the hell am I doin’ here?
    I don’t belong here”

  20. #20 tomtoo
    13. März 2017

    @Norbert

    Danke dir für deine Einschätzung. Ich denke auch über dieses “compressed” nach. So ne Art Zip Algo ? : )

    Schwer, Schwer

  21. #21 Marc
    13. März 2017

    @Norbert & tomtoo
    Also mir macht der Satz “BE WARNED THIS PROCESS CAN TAKE MONTHS” etwas zu schaffen. Wenn ich die Prozente richtig verstehe, liegt die Kompressionsrate bei 25%, ist das korrekt ?

  22. #22 tomtoo
    13. März 2017

    @Marc

    Wie kommst du auf 25% ?

  23. #23 tomtoo
    13. März 2017

    @Marc
    Das mit den Month’s könnte ja auch bedeuten das es jetzt sehr tricky wird ?

    Ich meine die Lösung von @Klaus war ja schon Hammer.

  24. #24 Marc
    13. März 2017

    Die 25% sind Unsinn, da habe ich mich verrechnet.

  25. #25 Klaus
    13. März 2017

    Interessant sind auch die Zwischenergebnisse der einzelnen Brüche, also Zähler geteilt durch die erste Zahl des Nenners, dann das Ergebnis durch die zweite Zahl teilen usw. Das erste oder die ersten beiden Teilergebnisse können wohl ignoriert werden, aber dann wird’s spannend: Die jeweiligen Nachkomastellen sind jeweils wieder 28-stellige Perioden (außer bei Bruch Nr. 9, dort sind es erwartungsgemäß 30 Stellen).
    Somit hätten wir auch eine ganze Menge zusätzlicher ‘Buchstaben’. Aber möglicherweise ist dies auch nur eine zwingende mathematische Folge.

    Hier die Teilergebnisse für den Bruch Nr. 1 (ohne das erste Teilergebnis) inkl.bereits bekanntes Endergebnis:
    7739463601532567049808429118
    5621182807935966010394142862
    6592557250242409899625080095
    3475418353203709643770907758
    3919869954474769565421331664
    7869106524946297427616779201
    5692379212922245638713122292

    Bruch Nr. 2:
    0658307210031347962382445141
    6343151556534963841211707377
    6470055027433200685528082457
    9667153220738196443720740506
    0696852474343028220357866367
    5462622220275499749781067415
    1192456316922245633192128713

    Bruch Nr. 3:
    3281086729362591431556948798
    7953278086429332588431256918
    5556289866470415617524816974
    1727958326926940980845284046
    3631260046962126681217647942
    4976887496697301988609150478
    3913461492133083638077255713

    Bruch Nr. 4:
    0501567398119122257053291536
    0896055122753654675812408827
    9752703159509429517472018446
    6440401078859464161983886186
    1588823489154411586182401352
    5518470195858818483970896403
    3013113792133083631176125613

    Bruch Nr. 5:
    3531870428422152560083594566
    6173582875528932203565184104
    9398215827931083398341276920
    2239851301878758303908687818
    4027154194730453593956530154
    0479021381967476006751352677
    2276837736762257925692123976

    Bruch Nr. 6:
    1026462478883871650763402700
    2138884208109907016550759440
    6018958675889032029902463058
    8663924754462068031728429719
    1492117619923731131176307077
    [hier nur 5 Ergebnisse, sonst meist 7]

    Bruch Nr. 7:
    3281086729362591431556948798
    8448327591379827637936207413
    8570913504566442793464168231
    5012707877240449974353965011
    5027965736260968046886288226
    6801546850607624826302368944
    7619924077199287139216778063

    Bruch Nr. 8:
    6656217345872518286311389759
    0758972448969034834517934552
    3141250930748824413533547843
    2715805163454622150937841807
    9991980168888675978092264538
    8316109159567269820816593819
    3913836336131114138363457276

    Bruch Nr. 9:
    684811007391652552942875523520
    937427324524098717647104743878
    122926195850825112405910449023
    129140772596891390507908342112
    638852917980062329854272724509
    504228992558065739162357368220
    033935125837923008001227847032
    111311463451311141372762211463
    [hier 8 Ergebnisse]

    Bruch Nr. 10:
    5708812260536398467432950191
    3917909032282538598687454952
    8175388740720847441835512363
    8107385725055946076305464456
    7898065688476028381603851465
    4552864232585834065047813259
    1976456325763783773092123776

    Bruch Nr. 11:
    3542319749216300940438871473
    0431112076724913870697414569
    1926490008689225581048943157
    3458813131703520375733270260
    2237784214483050875537907780
    3199275141635121767843786307
    1492111319774587139363255613

  26. #26 Thomas
    13. März 2017

    Ein spielerisches Beispiel dafür, einen “genetischen Code” mit der Code-Sonne zu lösen: https://www.simplyscience.ch/teens-liesnach-archiv/articles/der-genetische-code.html. (Lösung des Spiels: “simply perfect”). Man könnte z.B. dem entsprechend alle aus A, G, U gebildeten, zusammenhängenden Drei-Buchstaben-Kombinationen aus Norberts Zwischenergebnis #15 nehmen und durch Anagrammieren der mit der Code-Sonne erhaltenen Buchstaben nach einer Lösung suchen.

  27. #27 Thomas
    14. März 2017

    Pure chance?
    154 letters in # 15 – Goldman et al. encoded all 154 of Shakesspeare´s sonnets in DNA
    (http://www.nature.com/articles/nature11875.epdf)

  28. #28 Klaus
    14. März 2017

    Neue twitter Nachricht (14.3. …)

    https://twitter.com/666ab731

  29. #29 Klaus Schmeh
    14. März 2017

    >https://twitter.com/666ab731
    Is this a genuine message published by the Tengri 137 author? Is the PGP signature correct?

  30. #30 nimrodx0
    15. März 2017

    Hey guys!

    Today I found something very interesting in the recently shared mp3-file from the tengri137 – Twitter account. I used the Sonic Visualizer to analyze the the sound-file.

    Here is an image of it: https://i.imgur.com/vFGJ8Tg.jpg

    The image above shows a part of its spectrogram.
    A spectrogram is a visual representation of the spectrum of frequencies in a sound. Apparently an image of a link was coded into this sound-file.

    Here is the link: https://instaud.io/private/7fa2c325c0a7395c8856c5bb4f11b5616c6f60c5

    It leads to another sound file, which seems to be just a long repeating sequence of beep-sounds. By now i have not found anything interesting about this file. It seems there are no hidden images or texts in its spectrogram. I believe the message from the last Tweet refers somehow to this file.

    PS: If it says ‘The file was not found’ just add “/private/” after “instaud.io” to the link in the address bar. For some reason the browser deletes it sometimes after clicking on the link above.

  31. #31 tomtoo
    15. März 2017

    Second soundfile sounds like a old modem. 2 minutes is long. Maybe a picture.

  32. #32 Norbert
    15. März 2017

    I had a quick look at the waveform of the second soundfile. Choosing the right zoom factor, you can see “packets” that have a length of 16, 32, 48 … 128 ms. Probably they are supposed to be translated to octal numbers 0 .. 7?

  33. #33 tomtoo
    15. März 2017

    8Bits

  34. #34 tomtoo
    15. März 2017

    @Norbert sry nachtrag

    Maybe the Aliens love oldshool computing ; )

  35. #35 Norbert
    15. März 2017

    Transcript of the first five seconds (0 stands for 16 ms “packet”, 1 for 32 ms, … 7 for 128 ms):
    0 0 0 0 0 0 0 0 0 0
    0 0 0 0 0 0 0 0 0 0
    0 0 0 0 0 0 0 0 0 0
    0 0 0 0 2 1 3 0 7 0
    2 2 1 0 2 2 1 0 2 1
    3 0 3 3 0 1 0 3 1 2
    0 7 0 1 1 4 0 1 2 1
    1 0 1 0 1 5 1 0 2 3
    1 0 1 1 1 2 0 1 1 3
    1 0 2 4 0 1 0 1 1 3
    1 0 1 1 1 1 1 0 3 3
    0 2 3 1 0 1 0 2 2 1
    0 1 1 1 1 1 0 3 3 0
    1 0 6 1 0 5 1 0 2 2
    1 0 3 3 0 1 0 7

    …but needs proofreading!

    @tomtoo: 0..7: only three bits :-(

  36. #36 tomtoo
    15. März 2017

    @Norbert

    Can’t see the Signal.
    Looks much slower than i thought.

  37. #37 Norbert
    15. März 2017

    At ~7 sec 100 ms there is an extra long packet (144 ms), must be transcribed as 8 in my system, so it’s more than 3 bits per packet. Continuing until about 8 sec:

                    0 2
    4 0 1 0 1 1 1 2 0 2
    1 1 1 0 3 3 0 2 3 1
    0 1 0 1 1 4 1 0 1 2
    1 2 0 1 2 1 2 0 1 2
    1 2 0 1 2 0 1 5 0 2
    1 2 1 0 8 0 1 4 1 0
    5 0 3 1 0 5 0 3 1 0
    1 2 3 0 1 2 3 0

    Except for the very beginning and the very end of the waveform, two or more adjacent nulls seem not to appear (is null a letter divider?).

  38. #38 Norbert
    15. März 2017

    @tomtoo:
    For example, open the wav file with audacity (open source). In the German menu, choose Ansicht -> Vergrößern (ctrl-1), until you can see what I mean :-)

  39. #39 tomtoo
    15. März 2017

    @Norbert

    I wish i could, iam on a smartphone at the moment. : )

  40. #41 Norbert
    15. März 2017

    Sorry, bad link. This one should work:
    http://fs5.directupload.net/images/170315/ts3zoirq.png

  41. #42 tomtoo
    15. März 2017

    @Norbert

    Der kürzeste Impuls ist der Trenner.
    Und wieviele verschiedene Impulslängen gibts in der Nachricht ? Nur die 3 ?

  42. #43 tomtoo
    15. März 2017

    sry 4

  43. #44 Norbert
    16. März 2017

    Here is a transcript of the whole wav file. As described before, 0 stands for a 16 ms “packet”, 1 for 32 ms and so on. The maximum value is 8 (144 ms). This transcript has been automated, so it should be quite reliable.

    00000000000000000000000000000000002130702210221021
    30330103120701140121101015102310111201131024010113
    10111110330231010221011111033010610510221033010702
    40101112021110330231010114101212012120121201201502
    12108014105031050310123012301410141012301410141012
    30123012301410141012301410141012301230123014101410
    12301410141012301230123014101410123014101410123012
    30123014101410123014101410123012301230141014101230
    14101410123012301410141012301410141012301410123012
    30141014101230141014101410123014101410141014101230
    12301230123012301410141012301410141012301230141014
    10141014101230123012301230123014101410123014101230
    14101230141014101410123012301410123012301410141012
    30123014101230141012301410141012301230141014101410
    12301410141012301230123014101410123012301410123014
    10141014101230123014101410123014101410141014101230
    14101410123014101410141012301230141014101230141012
    30123014101230141014101230141014101410141012301410
    14101230141014101410123050310503102130702210221021
    30330103120701140121101015102310111201131024010113
    10111110330231010221011111033010610510221033010702
    40101112021110330231010114101212012120121201201502
    12108014105031050310123012301410141012301410141012
    30123012301410141012301410141012301230123014101410
    12301410141012301230123014101410123014101410123012
    30123014101410123014101410123012301230141014101230
    14101410123012301410141012301410141012301410123012
    30141014101230141014101410123014101410141014101230
    12301230123012301410141012301410141012301230141014
    10141014101230123012301230123014101410123014101230
    14101230141014101410123012301410123012301410141012
    30123014101230141012301410141012301230141014101410
    12301410141012301230123014101410123012301410123014
    10141014101230123014101410123014101410141014101230
    14101410123014101410141012301230141014101230141012
    30123014101230141014101230141014101410141012301410
    14101230141014101410123050310503102130702210221021
    30330103120701140121101015102310111201131024010113
    10111110330231010221011111033010610510221033010702
    40101112021110330231010114101212012120121201201502
    12108014105031050310123012301410141012301410141012
    30123012301410141012301410141012301230123014101410
    12301410141012301230123014101410123014101410123012
    30123014101410123014101410123012301230141014101230
    14101410123012301410141012301410141012301410123012
    30141014101230141014101410123014101410141014101230
    12301230123012301410141012301410141012301230141014
    10141014101230123012301230123014101410123014101230
    14101230141014101410123012301410123012301410141012
    30123014101230141012301410141012301230141014101410
    12301410141012301230123014101410123012301410123014
    10141014101230123014101410123014101410141014101230
    14101410123014101410141012301230141014101230141012
    30123014101230141014101230141014101410141012301410
    14101230141014101410123050310503103302310121101033
    02310121101033023101211000000000000000000000000000
    00000000000000000000000000000000000000000000000000
    00000000000000000000000000000000000000000000000000
    00000000000000000000000000000000000000000000000000
    00000000000000000000000000000000000000000000

  44. #45 Norbert
    16. März 2017

    If we consider zero as a letter divider (that’s purely hypothetical) and any sequence of figures between two zeros as a discrete letter, we get 27 different letters which I transcribed in the order of their appearing as follows:

      213: a
        7: b
      221: c
       33: d
        1: e
      312: f
      114: g
     1211: h
      151: i
      231: j
     1112: k
     1131: l
       24: m
    11111: n
       61: o
       51: p
     2111: q
     1141: r
     1212: s
       12: t
       15: u
     2121: v
        8: w
      141: x
        5: y
       31: z
      123: A

    Thus we can meta-transcribe the above transciption:

    abccadefbgheijklmelndjecndeopcdebmekqdjerssstuvwx
    yzyz
    AAxxAxxAAAxxAxxAAAxxAxxAAAxxAxxAAAxxAxxAAAxxAxxAAx
    xAxxAxAAxxAxxxAxxxxAAAAAxxAxxAAxxxxAAAAAxxAxAxAxxx
    AAxAAxxAAxAxAxxAAxxxAxxAAAxxAAxAxxxAAxxAxxxxAxxAxx
    xAAxxAxAAxAxxAxxxxAxxAxxxA
    yzyz
    abccadefbgheijklmelndjecndeopcdebmekqdjerssstuvwx
    yzyz
    AAxxAxxAAAxxAxxAAAxxAxxAAAxxAxxAAAxxAxxAAAxxAxxAAx
    xAxxAxAAxxAxxxAxxxxAAAAAxxAxxAAxxxxAAAAAxxAxAxAxxx
    AAxAAxxAAxAxAxxAAxxxAxxAAAxxAAxAxxxAAxxAxxxxAxxAxx
    xAAxxAxAAxAxxAxxxxAxxAxxxA
    yzyz
    abccadefbgheijklmelndjecndeopcdebmekqdjerssstuvwx
    yzyz
    AAxxAxxAAAxxAxxAAAxxAxxAAAxxAxxAAAxxAxxAAAxxAxxAAx
    xAxxAxAAxxAxxxAxxxxAAAAAxxAxxAAxxxxAAAAAxxAxAxAxxx
    AAxAAxxAAxAxAxxAAxxxAxxAAAxxAAxAxxxAAxxAxxxxAxxAxx
    xAAxxAxAAxAxxAxxxxAxxAxxxA
    yzyz
    djhedjhedjh

  45. #46 Norbert
    16. März 2017

    If, in the meta-transciption, the letter e is considered as word divisor, a possible decryption of the beginning is

    abccad fbgh ijklm lndj cnd opcd bm kqdj
    LITTLE MIND KNOWS WHEN THE GATE IS OPEN

  46. #47 Norbert
    16. März 2017

    Correction: “word divider”, not divisor …
    Surprisingly, the end reads like this:
    djhedjhedjh
    END END END

  47. #48 Norbert
    16. März 2017

    Next step: The AAxxAA part. Replacing A by zero and x by one, we get an ASCII encoded message.
    Hex notation:
    36 36 36 36 36 36 6d 37 78 36 78 35 72 65 67 63 2e 6f 6e 69 6f 6e

    plaintext:
    666666m7x6x5regc.onion

    Can anyone handle the TOR network? I can’t …

  48. #49 Norbert
    16. März 2017

    Interesting detail: TOR is the German word for GATE

  49. #50 tomtoo
    16. März 2017

    @ Norbert

    Great !

  50. #51 tomtoo
    16. März 2017

    @Norbert

    Ich glaub man braucht nur den TOR Browser. Hab ich aber nich nie versucht.

  51. #52 Renederberserker
    Rhede
    16. März 2017

    Kann den Link im Tor leider nicht öffnen. Ladefehler.

  52. #53 Norbert
    16. März 2017

    I see it’s no big deal to install and use a TOR browser …
    Well, “little mind knows when the gate is open” could imho mean that the server is available only at a certain time of day, or even date and time, and we might have to figure out when exactly this is.

  53. #54 Marc
    16. März 2017

    Probiert es doch mal um 03:07 Uhr nachts (AM). Die 666 steht bekanntlich für den Teufel und ab 03:00 Uhr soll ja bekanntlich die Stunde der Dämonen beginnen.

  54. #55 tomtoo
    16. März 2017

    Tja evtl. ist die Info ja auf Page 23 ?

  55. #56 Marc
    16. März 2017

    Das passt auch zum Satz “little mind knows when the gate is open”, für Sie sind “Kleingeister” Menschen, die an sowas glauben, was dann auch zum bereits entschlüsselten Text passen würde (DO NOT BELIEVE IN ANY GOD etc.).
    Das Problem dabei ist nur, für welche Zeitzohne die Uhrzeit angegeben ist. Evtl. ist diese Information in “x6x5regc” enthalten ?

  56. #57 Alex
    16. März 2017

    I think the translation above is not 100% correct.

    If the last sentence is “END END END” then the word MIND in “LITTLE MIND KNOWS WHEN THE GATE IS OPEN” can be maybe “BIRD”…

    = LITTLE BIRD KNOWS WHEN THE GATE IS OPEN

    The Twitter account… :)

  57. #58 Alex
    16. März 2017

    And one interesting (or better incredible) thing:
    in the pastebin file (http://pastebin.com/FAJNLpLZ) says the author “Nothing is random.” and gives us a number sequence “2, 8, 20, 28, 50, 82, …”

    This are the magic numbers in nuclear physics : https://en.m.wikipedia.org/wiki/Magic_number_(physics) . Only the number 126 is not present here. But i found the number on another place!

    So what is the magic behind this? The onion address is maybe a calculation and not a random address!!! (Nothing is random???)

    666666 m (7x6x5) = 126 (m = modulo)
    Don’t ask me what “regc” means…

    It will took 1.89 billion years to generate a onion address with 16 chars or 1800 years for one with 12 chars (666666m7x6x5) !!!

    Tested with a tool named SCALLION https://github.com/lachesis/scallion

  58. #59 Norbert
    16. März 2017

    Alex, you’re right. It’s LITTLE BIRD.
    Sorry for the mistake, but, you know, my brain is undergoing complete re-formatting at the moment 😉

  59. #60 Klaus
    16. März 2017

    @Norbert
    Really astonishing work!
    Do you think page 23 somehow could give a clue?
    And what with the “genetical encryption”?

  60. #61 Thomas
    17. März 2017

    Little bird – hummingbird? Have you found any humming sound file?

  61. #62 tomtoo
    17. März 2017

    @Norbert
    Könnte Page 23 nicht aus Elementabk. bestehen ? Das liest sich irgentwie so.
    Also U=Uran,N=Nitrogen,s=sulfur. Und dann evtl. aus der Protonen oder Neutronenzahl (magic numbers) ascii werden ? Ich kanns auf dem Handy nicht prüfen.

  62. #63 tomtoo
    17. März 2017

    @Norbert
    Muss ja nicht ASCII sein.
    Ist nur so eine Idee.
    Mach aus Zahlen Buchstaben und aus Buchstaben wieder Zahlen um daraus wieder Buchstaben zu machen.
    Ich bin irre muss der Formatierungsprozess sein.

  63. #64 tomtoo
    17. März 2017

    @Norbert
    Also was man ja auch mal schauen könnte ist, du kommst rein (Periodensystem) mit der Kernladungszahl gehst aber raus mit der Neutronenzahl. Evtl. ja deswegen die magic numbers ?

  64. #65 Thomas
    17. März 2017

    I wonder why the Index of Coincidence of Norbert’s decryption of page 23 (#15) matches that of english plaintext. Maybe a IoC-neutral cipher, e.g. a combination of transposition and monoalphabetic substitution (a single transposition can be ruled out because of the letter frequencies, a search for a simple monoalphabetic subsitution remained fruitless)?

  65. #66 tomtoo
    17. März 2017

    @Thomas
    Lets imagine about Page 23

    You have Letters to go into the periodic table. And go in with proton numbers but come out with neutron numbers. Could this work ?

  66. #67 Norbert
    17. März 2017

    @tomtoo: Dein Vorschlag für einen Lösungsansatz erscheint mir persönlich zu kompliziert – was natürlich niemanden davon abhalten soll, ihn zu testen: Probieren geht über Studieren. Es ist nur meiner Meinung nach so, dass man sich hier sehr schnell in einem Meer der Milliarden Möglichkeiten wiederfindet, die man unmöglich alle durchprobieren kann.

    Daher lieber eine nüchterne Bestandsaufnahme: Die Situation hat sich verändert, seit die Rätselmacher vor ein paar Tagen getwittert haben. Vorher war das BURUMUTREFAMTU-Rechteck eine reine Hypothese, nämlich die Anwendung des Prinzips, das für S. 17-22 einen sinnvollen Text ergeben hatte (dank Klaus), auf die Seite 23 – aber der resultierende Text war in diesem Fall eben nicht “sinnvoll”, was entweder bedeuten konnte, dass S. 23 völlig anders zu entziffern wäre, oder dass BURUMUTREFAMTU zwar ein korrekter Zwischenschritt, aber ein Rätsel im Rätsel ist. Nun haben die Autoren aber (auf pastebin.com, in der Twitter-Nachricht verlinkt) das komplette Rechteck gepostet, womit sie es meiner Interpretation nach als korrekten Zwischenschritt bestätigen. Zusätzlich weisen sie auf “126” hin (wissen wir dank Alex) und auf eine Wavedatei, die wiederum auf eine andere Wavedatei verlinkt (wissen wir dank nimrodx0), welche folgende Informationen liefert: “little bird knows when the gate is open” und eine Tor-Adresse, die vielleicht auch eine als Rechenaufgabe verschlüsselte Tor-Adresse ist (Alex), jedenfalls so wie sie da steht, im Moment nicht funktioniert.

    Mit etwas Abstand betrachtet erscheint mir folgende Frage wichtig: ist das, was sich hinter der Tor-Adresse verbirgt, eine Lösungshilfe zu BURUMUTREFAMTU oder ist umgekehrt das BURUMUTREFAMTU-Rechteck der Schlüssel, um die Tor-Informationen a) zu erhalten oder b) zu entschlüsseln? Wenn man will, kann man ja “READ THE NEXT TEXT CAREFULLY (…) THIS TEXTS CONTAINS THE UNICUE KEY” im Sinne der zweiten Möglichkeit verstehen.

    Nicht ganz klar ist mir auch, ob die Rätselmacher getwittert haben, weil die Entschlüsselung bis zu BURUMUTREFAMTU vorangeschritten war, oder ob sie nicht sowieso getwittert hätten – es war ja Pi-Day, der 14. März, und damit der Jahrestag der allerersten Twitter-Nachricht von Tengri(137) … Ein seltsames Zusammentreffen!

  67. #68 tomtoo
    18. März 2017

    @Norbert

    Danke dir. Du hast recht warten wir bis das Vögelchen singt.

  68. #69 Thomas
    18. März 2017

    @ Norbert

    In #18 you took “unicue” (key) for a misspelling and wrote “unique”. But maybe “unicue” is right. Googling it you get outcomes which apparently have to do with computer science (e.g. unicue ID). But since I’m no information scientist, that’s all Greek to me.

  69. #70 Alex
    18. März 2017

    I find out some very interesting thing about the term “Unicue” (it’s a >repetitive< plot device!!! )

    Technical term for a repetitive plot device. ie. One character is about to say "I love you" but this always causes the phone to ring.

    Read here: https://www.slangdefine.org/u/unicue-123b.html

  70. #71 Norbert
    18. März 2017

    I’d say there is just no chemical element whose symobl starts with Q which is why the author(s) encrypted “unicue”. Imho we should take it for “unique”.

  71. #72 Thomas
    18. März 2017

    @Norbert

    Ja, das ist natürlich eine gute Erklärung dafür, dass “unique” gemeint sein könnte. Aber siehst Du in “unicue key” keinen Sinn? Den Begriff “unicue” gibt es ja auch, und er wäre jedenfalls konkreter – ob er Sinn macht, kann ich nicht beurteilen – als ein “einzigartiger” Schlüssel.

  72. #73 Alex
    18. März 2017

    @Norbert you right! It makes more sense. I think it’s “unique” what the author(s) mean. Good explanation. Thanks.

  73. #74 Thomas
    18. März 2017

    Ich will nicht ausschließen, dass es sich bei den “unicue”- Fundstellen im Internet um Schreibfehler handelt und auch dort “unique” gemeint ist.

  74. #75 Norbert
    18. März 2017

    @Thomas: Ich meine halt, wir sollten nicht zu kompliziert denken. Wenn es eine naheliegende Erklärung gibt: Ockhams Rasiermesser, schnipp!

    Ich glaube übrigens inzwischen, dass es “die Lösung” von Tengri137 nie geben wird. Da hat jemand Spaß daran, uns bei der Stange zu halten und Endlosfortsetzungen seiner Rätsel zu schmieden. Da die Aufgaben ja bemerkenswert gut gemacht sind: warum nicht …

    Noch etwas zum BURUMUTREFAMTU-Rechteck: das Bemerkenswerte daran ist doch eigentlich die Regelmäßigkeit der Vokal-/Konsonantenabfolge. Das Muster springt einem ja förmlich ins Auge, deswegen dachte ich auch schon daran, dass es möglicherweise ein Dot-Matrix-Rätsel ist: Markiere alle Buchstaben, die ein bestimmtes Kriterium erfüllen, und das entstehende Muster zeigt dir die Lösung. Mit dem Kriterium Vokal/Konsonant hab ich ein bisschen rumgespielt, aber kein richtiges Ergebnis bekommen. Ich zeig’s trotzdem mal (X für Konsonant und ‘.’ für Vokal, die Zwischenräume nach Spalte 7 und Zeile 6 sind von mir eingefügt):

    X . X . X . X   X . X . X X .
    X . X . X . X   X . X . X X .
    X . X X . . X   X . X . X X .
    X . X X . . X   X . X . X X .
    X . X . X . X   X . X . X X .
    X . X . X . X   X . X . X X .

    . X . X . X .   X . . X . X .
    X . X . X . X   X . X . X X .
    X . X . X . X   X . X . X X .
    X . X . X . X   X . X . X X .
    X . X . X . X   X . X . X X .

    Links oben könnte man “IKI” lesen. Das reicht natürlich hinten und vorne nicht. Vielleicht gibt es ja andere Kriterien (“markiere die Buchstaben T, E, N, G, R, I” oder so etwas in der Art), bei denen ein sinnvolles Muster herauskommt? Aber möglicherweise bin ich jetzt selber dabei, zu kompliziert zu denken …

  75. #76 Michael
    18. März 2017

    Considering, that page 23 has something to do with “genetic coding” I am thinking about DNA. The DNA is
    build from amino acids. So I was looking for some kind of code connected with amino acids. Wikipedia says
    that there is a one letter equivalent for each amino acid. I discovered, that the letters in Norberts
    translation of page 23 has an equivalent letter in the list of amino acids. Here ist the result:

    B U R U M U T R E F A M T U
    Asx Sec Arg Sec Met Sec Thr Arg Glu Phe Ala Met Thr Sec
    N U R E S U T R E G U M F A
    Asn Sec Arg Glu Ser Sec Thr Arg Glu Gly Sec Met Phe Ala
    Y A P S U A Z B E H I M L A
    Tyr Ala Pro Ser Sec Ala Glx Asx Glu His Ile Met Leu Ala
    Z A N R U A Z B E N O M B A
    Glx Ala Asn Arg Sec Ala Glx Asx Glu Asn Pyl Met Asx Ala
    T O B I K O T L U B U M Y O
    Thr Pyl Asx Ile Lys Pyl Thr Leu Sec Asx Sec Met Tyr Pyl
    S U N O K U R G A N O Z Y I
    Ser Sec Asn Pyl Lys Sec Arg Gly Ala Asn Pyl Glx Tyr Ile
    O K U Z I K U F A U S I H E
    Pyl Lys Sec Glx Ile Lys Sec Phe Ala Sec Ser Ile His Glu
    Y A B E K A N S A B E R H O
    Tyr Ala Asx Glu Lys Ala Asn Ser Ala Asx Glu Arg His Pyl
    N A U E R A N S A H O T U E
    Asn Ala Sec Glu Arg Ala Asn Ser Ala His Pyl Thr Sec Glu
    K O R E M O R B I Z U M R O
    Lys Pyl Arg Glu Met Pyl Arg Asx Ile Glx Sec Met Arg Pyl
    S U N A K I R F A N E M B A
    Ser Sec Asn Ala Lys Ile Arg Phe Ala Asn Glu Met Asx Ala

    Perhaps I’m completely wrong. At the moment I have no idea how to proceed. Maybe someone else has an idea.

  76. #77 tomtoo
    19. März 2017

    Das mit meiner Idee bzgl. der Elementabk. kann man in der Pfeife rauchen. Geht nicht.

  77. #78 Norbert
    19. März 2017

    Die Idee mit dem genetischen Code ist ja zugegebenermaßen sehr naheliegend, aber ich komme auf keinen grünen Zweig, wenn ich überlege, wie das im Einzelnen ablaufen soll. Nehmen wir Michaels Ansatz (#76). “Asx” (die Übersetzung von B) ist nur ein Kürzel für “entweder Asn oder Asp”, wofür sollen wir uns entscheiden? Noch allgemeiner: Wenn der erste Lösungsschritt darin besteht, den BURUMUTREFAMTU-Text als eine Abfolge von Aminosäuren zu lesen, wäre der nächste ja logischerweise, jede Aminosäure in ihr Nukleobasen-Codon zu übersetzen, aber da hakt es, denn die meisten Aminosäuren haben mehrere mögliche Codons (Asn z.B. kann mit AAU oder AAC kodiert werden), dieser Schritt wäre also nicht mehr eindeutig.

    Umgekehrt würde ein Schuh draus: dazu müsste man in einem ersten Schritt aus BURUMUTREFAMTU eine Codon-Abfolge zaubern und könnte daraus in einem zweiten Schritt Codons zu Aminosäuren “dekodieren”, d. h. den Klartext mithilfe der Code-Sonne herstellen. Diese Reihenfolge würde auch eher dem Wortsinn von “UPCOMING TEXTS ARE GENETICALLY ENCRYPTED” entsprechen. Aber wie soll der erste Schritt vonstatten gehen? Mir fallen dazu bislang nur Möglichkeiten ein, die ich als viel zu kompliziert verwerfen würde.

  78. #79 Norbert
    19. März 2017

    (Fortsetzung)
    Die davon vielleicht am wenigsten komplizierte wäre folgende: Anhand einer geheimen Ersetzungstabelle (der Key, den es zu entschlüsseln gälte) wäre jeder Buchstabe des BURU-Geheimtextes einer der vier üblichen Nukleobasen zuzuordnen. Wenn also diese Tabelle z. B. vorsieht, dass B mit u (ich schreibe die Nukleobasen-Kürzel der Unterscheidbarkeit halber klein), U mit c und R mit u zu ersetzen seien, dann würde die erste Dreiergruppe BUR = ucu den Klartextbuchstaben S (für Serin) ergeben.

    Die Schwäche dieses Ansatzes besteht darin, dass eine durch drei teilbare Anzahl von Geheimtextbuchstaben zu erwarten wäre, was nicht der Fall ist. Aber diese Schwäche könnte genausogut eine Stärke sein! Bedenkt man nämlich, dass die Transkription von S. 23 aus Dezimalzahlen mit einer 14-stelligen Periode erstellt wurde und nimmt man die Textstelle REPEAT IT OFTEN NEVER BREAK IN THE MIDDLE dazu, dann könnte das bedeuten, dass jede Zeile dreimal hintereinander gelesen werden muss, wobei sich jedesmal eine neue Dreiergruppe ergibt:

    BUR UMU TRE FAM TUB URU MUT REF AMT UBU RUM UTR EFA MTU

    Aufgrund der Tatsache, dass die meisten Klartextbuchstaben durch mehrere verschiedene Codons verschlüsselt werden können, halte ich es durchaus nicht für ausgeschlossen, dass es so funktioniert. Wäre auf jeden Fall ein “Wow-Effekt”, also der Stil, den wir von den Rätselmachern kennen (und “compressed data” wäre es dann irgendwie auch).

  79. #80 Thomas
    19. März 2017

    Mein Ansatz mit der Code-Sonne #26 hat nichts gebracht; die zusammenhängenden AGU-Kombinationen sind zu wenige und ergeben keinen sinnvollen Text; im Übrigen kann ich mir auch nicht vorstellen, dass alle anderen Buchstaben Müll sein sollen.
    Auch wenn ich mich wiederhole: Bedeutet der Koinzidenzindex von ca. 0,065 nicht – falls er nicht durch eine bestimmte Wahl der Buchstaben gefaked ist – dass ein Kryptogrammbuchstabe jeweils einem Klartextbuchstaben entsprechen und eine Verschlüsselung vorliegen muss, die den IoC des englischen Klartextes nicht (wesentlich ) ändert? Oder unterliege ich da einem Irttum?

  80. #81 Norbert
    19. März 2017

    @Thomas: Nun ja, nehmen wir an, es wäre Substitution plus Transposition. Die Transposition verwürfelt die Buchstaben in eine, bei vordergründiger Betrachtung, zufällige Reihenfolge. Wir haben den IC = 0.065, wie du schreibst, dass heißt, die Wahrscheinlichkeit, dass zwei zufällig ausgewählte Buchstaben gleich sind, beträgt circa 1 : 15. Folglich müssten statistisch gesehen unter den 153 Buchstabenpaaren des Geheimtextes etwa zehn Doppelbuchstaben sein. Es kommt aber nicht ein einziger Doppelbuchstabe vor!

  81. #82 Steve
    19. März 2017

    @ Norbert

    Kann man eine Art Überlappung der 3-Buchstaben-Kürzel im Sinne des Pascalschen Dreiecks machen?
    Wir haben die Info der Form:
    X . X . X . X X . X . X X .
    B U R U M U T R E F A M T U
    Asx Sec Arg Sec Met Sec Thr Arg Glu Phe Ala Met Thr Sec

    Pascal 3-Eck in Grundform bezieht sich auf Basis 11, und zeigt meines erachtens nach die quadratiscche Verschachtelung von Zahlen in Wert und Spiegelsinn.
    Bsp.:
    11^2=121 oder grafisch überlappend
    11
    _11
    121
    11^3=1331 oder grafisch überlappend
    12
    _21
    11^4=14641
    13
    _13
    __31
    ___31

    Innerhalb dieser grafischen Repräsentation des Pascalschen Dreieicks gibt es einen tieferen Sinn zwischen Wert der Zahl und grafischem Aufbau, also einer Selbstrepräsentation wie von den Tengri Entwicklern erklärt: PI*7*PI^7.

    Es gibt eine Symmetrie die sich in den Zeilen 11-14 zeigt, welche als Art Pol-Punkt und Bedingung ansehen kann.
    So zeigt sich in in Zeile 14 die Folge:
    .1001.2002.3003.
    Zeile 15:
    .3003.5005.
    Zeile 16:
    .8008.
    Zeile 11 Polpunkt:
    .11.55.
    .66.

    Interessant wird es wenn man rekursive Schritte in Betracht zieht:
    11^2 .. 11^3 .. 11^4 …;
    22^2 .. 22^3 …

    Für die ganzen Zahlen 1,5,6,7 gibt es Besonderheiten da hier die Lösung direkt im Muster gezeigt wird( 5,6) oder als Summe seiner Selbst und dem Folge Wert der neuen Zeile.
    Beispiel für Folge8:
    Zeile1 = 704.
    Zeile 11:704 wird in Betrachtung vom Pol aus zu 7744.
    Zeile 1115: 704 704 (Operator Bereitstellung)
    704
    _704 =7744

  82. #83 Klaus
    19. März 2017

    @Norbert #79:
    Dann könnte man sich den Umweg über das Periodensystem ggf. sparen. Um bei Deinem Beispiel zu bleiben: anstelle B mit Nukleobase u zu ersetzen kann man direkt die Zahl 56 mit u ersetzen, 92 mit c und 37 mit u.

    Denkbar ist auch die Verwendung von 3-stelligen Tripletts, wobei man die Reihe dann wie von Dir angeregt fortschreiben kann (da ja 28/3 9 Tripletts ergibt mit einem Rest):
    Ergebnis erster Bruch:
    569 237 921 292 224 563 871 312 229 256 923 792 129 222 456 387 131 222 925 692 379 212 922 245 638 713 122 292
    Insgesamt 28 Triplets.
    Bruch Nr. 9 ergibt 10 Tripletts (keine Fortschreibung erforderlich).
    Eines für jeden anderen Bruch?
    Insgesamt leider mehr als 64 Tripletts (die Anzahl der möglichen Basentripletts).

  83. #84 Renederberserker
    Rhede
    19. März 2017

    Hallo zusammen. Es gibt eine App die ich seit Jahren zum Geocachen benutze. Sie heißt GCC. Dort gibt es alle möglichen Tools zum entschlüsseln. Eine Verschlüsselungsmethode darin heißt DNA. Vielleicht hilft das. Mfg. René

  84. #85 Michael
    19. März 2017

    GCC kenne ich auch, wenn man B U R U M U T R E F A M T U eingibt, kommt CGUAUGACUCGUGAAUUUGCUAUGACU heraus. D.h. B und U werden ignoriert. Ich bin mir nicht sicher, ob das wirklich weiterhilft

  85. #86 Norbert
    19. März 2017

    @Klaus:

    Dann könnte man sich den Umweg über das Periodensystem ggf. sparen.

    Guter Einwand, und ein starkes Argument gegen diese Theorie. Immerhin hat das Tengri-Team “B U R U M U T R E F A M T U” etc. gepostet und nicht “56 92” etc.

    @Renederberserker, Michael: GCC ist auch auf meinem Handy – und hatte mir unter “Periodensystem” für die Ordnungszahl 114 leider U ausgespuckt, wegen der veralteten Bezeichnung Ununquadium, F ist die richtige(re) Antwort. Das Prinzip bei GCC’s “DNA” ist äquivalent zur Code-Sonne. B lässt sich nicht kodieren. Wenn ich mich bei Wikipedia richtig eingelesen habe, könnte man aber in der Code-Sonne noch Klartext-U bei UGA und Klartext-O bei UAG einfügen. Dann lassen sich alle Zeichen des englischen Alphabets bis auf B, J, X, Z kodieren.

    @Steve: Sorry, den Zusammenhang mit den aktuellen Fragestellungen verstehe ich nicht.

  86. #87 Renederberserker
    19. März 2017

    Hallo. Mir ist Grad aufgefallen dass wir hier 23 Taxte haben. Und wir Menschen haben doch 23 Chromosomenpaare. Wobei sich bei dem 23. Chromosom entscheidet ob wir männlich oder weiblich sind. Also hat die Nummer 23 ja generell diese x/y Besonderheit. Vielleicht ist da das Geheimnis versteckt. Nur Mal so als Idee. Mfg.René

  87. #88 Steve
    20. März 2017

    @ Norbert:
    Hab mich da auch schwerfällig ausgedrückt.
    Ich dachte da an eine Art von zwei Bezeichnungen die eine neue erwirken.
    Hat was mit kabbalistischer/ gnostischer Wort- und Zahlspieltheorie zu tun.
    Die hebräische Schrift wird ja auch als Zahlenwert angesehen. Wenn man das mit dem Pascalschen Dreieck verbindet, wachsen die Zahlen spiegelbildlich. Zwei Bedeutungen in einer Zeile: Die geschriebenen Ziffern oder die Verschmelzung der Ziffern.
    Bsp:
    11^4= 14641 :> 1.4.6.4.1
    11^5= 16151 :> 1.5.10.10.5.1

  88. #89 tomtoo
    20. März 2017

    Also irgentwie sind die “Aliens” ja auch Zahlenaffin. Mir ist da etwas aufgefallen.

    154(gerade Zahl)/2= 77

    Teiler von 154
    1; 2; 7; 11; 14; 22; 77; 154

    2*7=14 Reihen
    11 Zeilen

    11/7 ca. golden ratio

    Evtl. Zufall und ob’s hilft ?

  89. #90 Thomas
    20. März 2017

    “nothing is random”:
    Der Kreis im goldenen Schnitt geteilt ergibt 137,5 Grad ( Tengri 137!)

  90. #91 tomtoo
    20. März 2017

    ; ) kleiner Nachtag:

    Selbst die 22 auf dem Kopf auf den alten Taschenrechnern ergibt 77.

  91. #92 tomtoo
    20. März 2017

    Es gab ja auch 7 Pulsweiten + Trenner.
    Wie die 7 Teiler plus Trenner.

    Aber wie geht’s zusammen ?

    Hilfe ! ; )

  92. #93 Marc
    20. März 2017

    @tomtoo #89
    oder 22/7 ca. PI 😉

  93. #94 tomtoo
    20. März 2017

    @Marc

    Arghh. *Kopfschuss*

    ; )

  94. #95 tomtoo
    20. März 2017

    Also das man aus 154 , PI und den goldenen Schnitt extrahieren kann war mir neu.
    Respekt.

  95. #96 tomtoo
    20. März 2017

    I have an idear. We ask the scientists on the numberphile channel on youtube.

    Let’s talk with them. I think they would love thinks like that. Come on. Show the “Aliens” that we are close to the next step.
    ; )

  96. #97 QuantumCannibal
    Onion
    23. März 2017

    666666m7x6x5regc

    If you are using “scallion” then it would take a long time, however, by the looks of the onion it’s more likely it was generated with Eschalot.

    Eschalot can find longer human-readable names like seedneedgoldcf6m.onion, hostbathdarkviph.onion, etc.

    And is pretty fast according to the documentation.
    https://github.com/ReclaimYourPrivacy/eschalot

  97. #98 Jamess
    computer code for brain processor
    23. März 2017

    The last page with the cube of letters means NOTHING f you try to “decode it” It is a computer program written only so that a certain brain can process it and must be read without stopping and then the brain will transform and unpack it to a huge size. It is like a zip or rar compressed file.

  98. #99 Jamess
    23. März 2017

    Michael you may be right but that will not bring you any closer to knowing the program just think about the information that is contained by just 4 Amino acids with all the possible combinations as JHWH says it is IMPOSSIBLE to figure out, it has to be unpacked and installed into a certain human brain.

  99. #100 Jamess
    23. März 2017

    This is obviously no game and the PROOF is in the pudding, literally. This is DEADLY serious and the entire survival of our civilization depends on whether we have learned enough to survive.

  100. #101 kartana
    Germany
    24. März 2017

    If you take the BURUMUTREFAMTU “as is” and see it as a cube what strikes me is the repetition of the letters if you look at them as sequences for the top to the bottom. You have AA for times as well as RR, UU etc etc. multiple times. “Nothing is random.”

  101. #102 kartana
    24. März 2017

    Not only that, you have whole repeating groups like UR UR, UTRE UTRE, ANSA ANSA

  102. #103 tomtoo
    24. März 2017

    Wie ist das mit den 2% auf 50% ?
    Ich käme da auf 3850 Zeichen ?
    Wie seht ihr das ?

  103. #104 Maria
    Colorado
    24. März 2017

    “LITTLE BIRD KNOWS WHEN THE GATE IS OPEN”
    Has anyone considered that the “GATE” could be connected to CERN which just got a “heart transplant” 2 days ago?

    https://steemit.com/science/@lemouth/live-from-cern-cms-got-a-heart-transplant?utm_content=bufferd0871&utm_medium=social&utm_source=twitter.com&utm_campaign=buffer

  104. #105 Maria
    24. März 2017

    reading through the article I posted above, ONION address coincidence?: The CMS detector has been designed to be able to reconstruct a wide range of particles arising from highly energetic LHC collisions.

    It has a onion structure. This means what it means: the CMS detector looks like an onion! Really!

    An onion is made of several layers, as the CMS detector, as shown by the different layers being indicated by various colors on the picture on the left.

  105. #106 Maria
    24. März 2017

    Maybe of importance:
    lemouth67 · 2 days ago

    The photon is definitely massless. That is a theoretical prediction. Even a super strong one, actually.

    There are experiments trying to falsify this statement. They have however so fair all failed, and the resulting upper limit on the photon mass is something like 10-18 eV, which is about 1.7 x 10-54 kg. The information can be found in the 2016 Particle Data Group review.

  106. #107 tomtoo
    24. März 2017

    @Jammes

    I have the feeling that most readers in this room like great riddles. But dont think that “Aliens” are involved.

  107. #108 kartana
    24. März 2017

    I can’t imagine page 23 being an actual text, meaning that it is not supposed to be decoded as a actual spoken language like the previous pages. If we talk about a key that unlocks something hidden, it would make more sense if it is a combination of numbers or even a picture. It has to be something universal like that.
    “No one will know if anyone got the reward” so we might never be 100% sure if we have solved it or not.

  108. #109 kartana
    24. März 2017

    Also, regarding the Little Bird. The only mentioning of a little bird in the Hebrew Bible is in Ecclesiastes 10:20. So lets try at 10:20 maybe?

  109. #110 Maria
    25. März 2017

    Published on Mar 24, 2017

    WARNING: Anthony Patch – CERN Will Resurrect NIMROD and His Band of Nephilim Demon
    @14 minutes in youtube video below a discussion of the Vatican, CERN, May 1st experiments, DNA Heaven/Earth cross day etc…connected?

    Check out CERN’s LOGO 666!!! http://home.cern/scientists/events

    https://www.youtube.com/watch?v=LyVK0Vp0rNo

    http://www.christiananswers.net/dictionary/nimrod.html

  110. #111 Maria
    Colorado
    25. März 2017

    I feel CERN is an important link to the puzzle you all are trying to solve. I am not a scientist, but this seems like it is an important piece since you have been discussing the Fine Structure Constant:

    666 CERN event in 4 days!!!

    Measurement of the running of the fine structure constant below 1 GeV with the KLOE detector

    Description

    Precision physics requires appropriate inclusion of higher order effects and the knowledge of very precise input parameters of the electroweak Standard Model. One of the basic input parameters is the effective QED coupling constant α(s) which depends on the energy scale because of charge screening by vacuum polarization. Hadronic non-perturbative effects limits the accuracy of α(s) from low energy to the Z mass scale. We present the measurement of the running of the QED coupling constant in the time-like region 0.6 < √s < 0.975 GeV with the KLOE detector at DAΦNE , using the ISR differential cross section dσ(e+e− → μ+μ− γ)/d√s. The result shows a clear contribution of the ρ−ω resonances to the photon propagator with a significance of the hadronic contribution to the running of α(s) of more than 5σ. It represents the first measurement of the running of α(s) in this energy region and the strongest direct evidence achieved in both time- and space-like regions by a single experiment. For the first time, also the real and imaginary part of Δα(s) have been extracted, showing clearly the importance of the role of the imaginary part. From a fit to the real part of Δα(s) and assuming lepton universality, the branching ratio BR(ω → μ+μ−) = (6.6 ±1.4stat ±1.7syst) · 10−5 has been obtained.

    https://indico.cern.ch/event/586436/

  111. #112 kartana
    25. März 2017

    They (CERN) were supposed to open the gates to hell so many times already… I don’t think we need to be concerned about that now. If anything my personal believe is IF their machine(s) have some kind of impact than it is related to the Mandela Effect and Infinite Realities.My believe goes as far as that we, meaning the thing we live on, is the center of attention. There is nothing in outer space and everything just overlaps each other through multiple alternative realities. That time isn’t linear. But that is a topic of this blog here.

    • #113 James
      25. März 2017

      Kartana if you haven’ t noticed how many demons have entered the world since Cern started then you are too far gone to be saved. Satan is on a rampage and loving every minute of it. Who else but Satan would have knowledge of all that tengri 137 math and he even says he is not God.

  112. #114 Steve
    25. März 2017

    “Dies ist das Wissen des lebendigen Buches, das er offenbarte den Äonen am Ende als [seine Buchstaben], indem er offenbarte, wie sie keine Vokale waren noch Konsonanten, so daß jemand sie lesen und an etwas Eitles denken könnte,sondern sie sind Buchstaben der Wahrheit, welche allein die sprechen, die sie kennen. Jeder Buchstabe ist ein voll-ständiger *Gedanke* wie ein vollständiges Buch, weil sie Buchstaben sind, die geschrieben wurden von der Einheit,wobei der Vater sie aufgeschrieben hat für die Äonen, damit durch diese seine Buchstaben sie den Vater erkennen.”

    https://de.scribd.com/doc/108690448/Ludemann-Janssen-Bibel-der-Haretiker-Nag-Hammadi-Schriften

  113. #115 kud gt
    25. März 2017

    @Steve
    Volltreffer!

    Gesucht: Der DNA Algorithmus der Komprimierung dieser “Gedanken”.

    Das Buchstabenviereck hat dazu was von einem Mäuselabyrinth.

    @Klaus
    “EVERYTHING THAT EXISTS IS BASED ON AMATHEMA”
    Heißt das wirklich bei der Entkodierung “AMATHEMA” nicht “MATHEMATIK”?
    Nichts ist Zufall…

  114. #116 Alex
    25. März 2017

    Heiliger Strohsack…

    Komprimiertes wissen: “Jeder Buchstabe ist ein voll-ständiger *Gedanke* wie ein vollständiges Buch, weil sie Buchstaben sind, die geschrieben wurden von der Einheit,wobei der Vater sie aufgeschrieben hat für die Äonen,”

    DNA Informationen durch Vererbung: “…damit durch diese seine Buchstaben sie den Vater erkennen.”

    Wenn das stimmen sollte, dann ist dies aber jetzt kein einfaches Puzzle, oder irre ich mich gewaltig?

  115. #117 Norbert
    25. März 2017

    @Alex: Jau – ich glaube, ich setze auch besser mal einen Aluhut auf beim Weiterrätseln, sicher ist sicher 😉

    @kud gt: siehe Jims Kommentar #12: Es heißt korrekt “a mathematical truth”.

    @alle: Ich habe meinen Ansatz von #79 am Computer durchgespielt und keine Lösung gefunden (simulated annealing). Ich denke inzwischen, entweder ist mit dem BURUMUTREFAMTU-Rechteck die Runde fertig gespielt, und in der nächsten Runde kann man es vielleicht in irgendeiner Form sinnvoll einsetzen, oder es verbirgt sich doch noch eine Information dahinter, die dabei hilft, die Onion-Adresse aufzurufen. Im letzeren Fall wäre das vorzugsweise eine Uhrzeit. Kann man das Muster, das ich bei #75 gepostet habe, eventuell als Runen mit Zahlenbedeutung lesen?

  116. #118 kud gt
    25. März 2017

    @Norbert:
    Danke, das hatte ich vor Tagen gelesen und nicht behalten.
    Wenn Seite 22 wahr ist, dann kommen maximal Hilfen, aber keine Runden mehr – sonst ist die Wahrheit der Macher nur eine Halbe.

    Vermute mittlerweile Mathematiker/Informatiker irgendeiner Vereinigung dahinter.
    Im Viereck ist kein C, D, J, Q, V, W und X.
    Die Buchstabenhäufigkeit:
    a b e f g h i k l m n o p r s t u y z
    19 10 12 6 2 4 7 7 2 9 10 12 1 12 7 6 18 4 6 ∑154
    a u e r o b n m k i s t f z h y l g p
    19 18 12 12 12 10 10 9 7 7 7 6 6 6 4 4 2 2 1

    Nach “12244666777” gesucht, kommt ein HDF-File https://de.wikipedia.org/wiki/Hierarchical_Data_Format der NASA – das wären zwar große Datenmengen, ist aber zu weit her geholt.

    Wenn das mit dem “LAST MESSENGER” stimmt, dann ist vielleicht doch schwerer als alles zuvor.
    Dazu haben sie die DNA-Karte noch gar nicht wirklich gespielt. Aber dafür auf den Seiten eine Menge Text genutzt.

    • #119 Alex
      25. März 2017

      @kud gt: lt. Wikipedia ist es nicht mal so abwegig was du gefunden hast. Große Datenmengen und Supercomputer?

      “HDF wurde vom National Center for Supercomputing Applications (NCSA) entwickelt, das auch die Software-Bibliotheken zur Benutzung des HDF zur Verfügung stellt. Um auf einem Supercomputer erzeugte Daten auch offline weiterbearbeiten zu können, gibt es Portierungen auf alle gängigen Betriebssysteme. HDF ist das vorgeschriebene Datenformat für die Datenprodukte des NASA Earth Observing System.”

  117. #120 kud gt
    25. März 2017

    Ohne an die Tor-Adresse zu denken und ohne das Viereck, strikt am Text von Seite 22 gesegelt:
    Was ist unser BRAIN? Metaphorisch.
    Unsere Rechner? Mobilen Geräte? Handys?
    Woher wissen die, wie viel EMPTY PLACE wir haben, von dem 50% danach belegt ist bzw. dass sie davon zwei Prozent bereits “nutzen”? Geht nur, wenn die das bereits irgendwo an-/abgelegt haben.

    PURE STATE OF MIND – das hört sich alles danach an, als ob jemand das Formatieren eines Rechners und das Neuaufsetzen des Betriebssystems mit deren Zusatzsoftware für die DNA-Nachrichten beschreibt, als neue Kommunikationseinheit für ihren MESSENGER.
    Und keiner soll je erfahren, wer es ist und ob er gefunden wurde. Rekrutenstimmung in der Cryptowelt… 😉

  118. #121 kud gt
    25. März 2017

    @Alex
    War auch der Grund, warum ich es überhaupt erwähnenswert fand. Allerdings konnte ich ärgerlicherweise keine freie Software finden, welche die Datei öffnet ohne gleich einige Packages und Programmiersprachen auf die Maschine zu laden.

  119. #122 tomtoo
    25. März 2017

    @kut gt
    Ich bin da echt doof. 154 Zeichen sind 2%. Hab überlegt ob evtl. so ein Banner druck in frage käme ? Aber passt auch nicht so recht.

  120. #123 tomtoo
    25. März 2017

    Achso zurückspulen.
    154 Zeichen sind 2%.

  121. #124 kud gt
    25. März 2017

    YOUR KNOWLEDGE CAN NOT HELP AT THIS POINT
    WE HAVE EMBEDDED THESE SKILLS IN OURR GENES
    WHO HAS THE CORRECT GENETIC CODING WILL UNDERSTAND THIS TEXT
    ALL OTHERS WILL FAIL

    Versuchte freie sinngebende Übersetzung:
    Fertige Software wird ab hier nicht mehr helfen.
    Nur wer den richtigen Sourcecode (bzw. nach dem Compilen: GENETIC CODING, Maschinensprache – die Sprache der Mathematik) hat, den wir bereits als OpenSource (OUR GENES schreiben sie, nicht YOUR) abgelegt haben (praktisch die Gene für eine Menge Software und viele Entwickler), wird das hier verstehen. Der Rest scheitert – ohne diese Sourcen.

    Gesucht wird also ein Entwickler?

    MESSENGER – Überbringer, Bote, Botschafter evtl. in dem Kontext Erfinder oder sogar Prophet, wenns dann religiös gesehen wird, was die(se) Zahlenfetischisten, nicht ganz zu unrecht auch verurteilen.

    Ist die komplette Forschung zum
    https://de.wikipedia.org/wiki/Humangenomprojekt
    und die dazugehörige Entschlüsselung frei zugänglich?

    Dass die nicht wollen, dass die Lösung des Rätsels von eine Gruppe erarbeitet wird, finde ich mehr als seltsam: Einerseits beschweren die sich, dass die Menschheit am Scheideweg steht und andererseits befördern die Einzelkämpfertum.

  122. #125 kud gt
    25. März 2017

    Nachtrag:
    http://www.pbs.org/wgbh/nova/body/cracking-the-code-of-life.html
    Für alle, die sich einarbeiten wollen:
    http://www.gutenberg.org/ebooks/author/856
    Bisher nur spärlich nachgefragt.

  123. #126 Marc
    25. März 2017

    @ #98 – #100
    :-)

  124. #127 kud gt
    26. März 2017

    Zum Sonntag was zum Schmunzeln:

    THE REWARD IS THE ACCESS TO OUR ETERNAL LIBRARY
    UPCOMING TEXTS ARE GENETICALLY ENCRYPTED

    http://www.theeternallibrary.com/inthepress/dna/

    Seite 1:
    IS NOT KNOWING. ONLY WITH KNOWLEDGE YOU WILL FI ND ENLIGHTENMENT. LIKE THE OTHERS BEFORE YOU, YOU WILL UNDERSTAND EVERYTHING BETTER.

    Seite 4:
    YOUR BELIEF. TENGRI WHO BROUGHT YOU AGAIN AND AGAIN ENLIGHTENMENT IS CAPABLE.

    Seite 10:
    WE AR E THE ENLIGHTENED. WE WERE ALWAYS THERE AND BROUG HT ENLIGHTENMENT.

    Headline des Artikels neben dem Eternal Library-Artikel in der Zeitung DNA India: Towards Enlightenment
    http://epaper.dnaindia.com/epapermain.aspx?pgNo=2&edcode=820028&eddate=2013-08-23
    Geschrieben von Amrita Nayak Dutta – Anfangsbuchstaben: DNA – rückwärts. 😉

    Zufälle gibts… Nicht, nach tengri137.

  125. #128 kud gt
    26. März 2017

    Ist der “Übersetzter” der tengri137 Seiten 1-16 bekannt?

  126. #129 kartana
    26. März 2017

    How do you get line 9 of the BURUMUTREFAMTU cube?
    Isn’t line 7:
    11 13 11 46 34 51 31 11 41 37 27 62 21 14

    Wouldn’t it be N A N P etc…. then?

  127. #130 kartana
    26. März 2017

    Line 9 I mean, not 7. How do you come to line 9 being
    N A F E R A N S A H O T F E ??

    GACT are DNA components and GACU are RNA components. All 5 are on page 23. If you isolate those on the BURUMUTREFAMTU cube, they make an interesting pattern.

    The regularity of the letters are what I can not take my eyes off.Of course C is missing but it should be in line 9 at number 27 and I don’t know why it isn’t. I don’t understand line 9 in the BURUMUTREFAMTU cube.

    • #131 James
      28. März 2017

      C is probabliy missing because Tenegri is not human and neither is the contactee.

  128. #132 kartana
    26. März 2017

    Regarding the missing Cytosine in the result, given that the NAFERA… is correct:

    Cytosine has not been found in meteorites, which suggests the first strands of RNA and DNA had to look elsewhere to obtain this building block. Cytosine likely formed within some meteorite parent bodies, however did not persist within these bodies due to an effective deamination reaction into uracil.

    (this blog really needs a way to edit comments)

  129. #133 kud gt
    26. März 2017

    @kartana
    Post #15 (Norbert) describes the solution of Line 9.

    tengri137 themselves, I think their bot, posted the actuall solution here http://pastebin.com/FAJNLpLZ

  130. #134 James
    26. März 2017

    If as Tengri says this is a genetic code and no one can decode it without the proper genes, I hope all the people attempting this have tried to discover if they posses this genetic sequence. But this could all be a trick meant to mislead people into following a wrong path. The reference to entertainment is especially concerning. While I love the pleasures afforded by our perception of our physical senses, I am worried about the abuse that can come out of it. Tengri has eluded to the abuses associated with religion but religion is also associated with the golden rule which for me is the most important cause and effect rule associated with our existence.

  131. #135 kud gt
    26. März 2017

    ?
    Lines vs. rows (direction of reading) top-down, right-left, all reverse, diagonal, …
    Combination of transposition and monoalphabetic substitution (after monosub ?trans key, read and cut letter: 2, 8, 20, 28, 50, 82, 126)

  132. #136 anniusverus
    27. März 2017

    The right genetic code could mean that you must be from a certain place on earth, doesn’t the mp3 tune sound like a Australian or Indian chant ? If you let a shaman, priest or similar from either of these cultures chant the letters in the cube it could produce ‘something’, a meaning.

    • #137 James
      28. März 2017

      Its probably Miguel Ruiz. He’s a Shaman. A surgeon, An author of The 4 Agreements about the true reality of life.

  133. #138 anniusverus
    27. März 2017

    Like a chewing gum paper, languages. I feed the cube of text into Google translate, trying to find a read out loud rhyme in different languages, then i saw something when text was translated to Turkish (ref. to all the symbols in the pdf). A google translate creates whole sentences which translates to ‘METHOD OF APPLICATION … “. Sorry for spam, pastebin here https://pastebin.com/BdK6FD4X

  134. #139 beau
    United States
    27. März 2017
  135. #140 tomtoo
    28. März 2017

    @anniusversus

    Yep. Also an idea of mine. Some kind of slang talk that comes out. Maybe south afrikan ? I dont know. But that would be very unpreciese from the “aliens”.That would disapoint me.

  136. #141 kartana
    29. März 2017

    Anyone tried psychedelic drugs and then tried to read the text? They talk about a pure state of mind. Also what is your opinion on the ³³౿¹ file?

  137. #142 Klaus
    30. März 2017

    Tengri hat wieder was gepostet:

    https://pastebin.com/YUPZsz9n

    Und zwar den BURUM-Text rückwärts. Mit einem kleinen Fehler (?) in der zehnten Zeile, nämlich ORN anstelle ORM.

  138. #143 Thomas
    30. März 2017

    (Reversal may be a part of transposition): I´m quite sure “AFRIKANUS” in row 16 is no coincidence..

  139. #144 kartana
    30. März 2017

    Das mit dem M->N ist schon komisch irgendwie. Wenn nix zufällig ist… dann auch das nicht.

  140. #145 Jeffrey
    31. März 2017

    B U R U M U T R E F A M T U
    N U R E S U T R E G U M F A
    Y A P S U A Z B E H I M L A
    Z A N R U A Z B E N O M B A
    T O B I K O T L U B U M Y O
    S U N O K U R G A N O Z Y I
    O K U Z I K U F A U S I H E
    Y A B E K A N S A B E R H O
    N A F E R A N S A H O T F E
    K O R E M O R B I Z U M R O
    S U N A K I R F A N E M B A
    +
    U T M A F E R T U M U R U B
    A F M U G E R T U S E R U N
    A L M I H E B Z A U S P A Y
    A B M O N E B Z A U R N A Z
    O Y M U B U L T O K I B O T
    I Y Z O N A G R U K O N U S
    E H I S U A F U K I Z U K O
    O H R E B A S N A K E B A Y
    E F T O H A S N A R E F A N
    O R N U Z I B R O M E R O K
    A B M E N A F R I K A N U S
    =
    BU UT RM UA MF UE TR RT EU FM AU MR TU UB
    NA UF RM EU SG UE TR RT EU GS UE MR FU AN
    YA AL PM SI UH AE ZB BZ EA HU IS MP LA AY
    ZA AB NM RO UN AE ZB BZ EA NU OR MN BA AZ
    TO OY BM IU KB OU TL LT UO BK UI MB YO OT
    SI UY NZ OO KN UA RG GR AU NK OO ZN YU IS
    OE KH UI ZS IU KA UF FU AK UI SZ IU HK EO
    YO AH BR EE KB AA NS SN AA BK EE RB HA OY
    NE AF FT EO RH AA NS SN AA HR OE TF FA EN
    KO OR RN EU MZ OI RB BR IO ZM UE NR RO OK
    SA UB NM AE KN IA RF FR AI NK EA MN BU AS

    complete symmetrical, so , half of this result is like the following:
    BU UT RM UA MF UE TR
    NA UF RM EU SG UE TR
    YA AL PM SI UH AE ZB
    ZA AB NM RO UN AE ZB
    TO OY BM IU KB OU TL
    SI UY NZ OO KN UA RG
    OE KH UI ZS IU KA UF
    YO AH BR EE KB AA NS
    NE AF FT EO RH AA NS
    KO OR RN EU MZ OI RB
    SA UB NM AE KN IA RF

    “OO” Locate at center point, any idea what is this??

  141. #146 kartana
    31. März 2017

    Oxygen?

  142. #147 kartana
    31. März 2017

    Also isn’t it normal that it ends up symmetrical like that?

  143. #148 noShitBruh
    31. März 2017

    so i read the last page and believe it or not my mind opened like a f*ckin coke can instantly !!
    i went to the cosmic library and i dont know why but the first thing i thought of is “i wonder if E.T have some porn books ?”
    and yes , they have !! and f*ck its weird ! iam shocked now…
    anyway it was one of the best trip i had !
    now back to work ^^

    • #149 James
      3. April 2017

      Sounds like someone had a nice trip at least because if anything was revealed it sure wasn’t posted here

  144. #150 kartana
    1. April 2017

    I still would like an explanation for line 9 on page 23! Norbert did leave out numbers to make it fit the pattern (explained here: http://scienceblogs.de/klausis-krypto-kolumne/2017/01/29/tengri-137-who-can-solve-this-encrypted-book/#comment-844743)

    But why? What was the mathematical reason behind this?

  145. #151 Norbert
    4. April 2017

    @kartana:
    In post #6, I just made an observation. No figure has to be omitted. In fact, it turned out that the line

    11 13 11 46 34 51 31 11 41 37 27 62 21 14 63

    as calculated and posted by Jim, should be read like this:

    11 13 114 63 45 13 11 14 13 72 76 22 114 63

    which means that we have some three-digit numbers here. Then, using the atomic number decryption as discovered by Klaus, you get

    N A F E R A N S A H O T F E.

    As you can see, I firstly posted “N A U E R A N S A H O T U E”. This is because my app decoded 114 to the obsolete name Unumquadium (U), whereas in 2012, the official name of element #114 was set to Flerovium (F).